Busch Lab

ZMP

ACOT12

Ensembl ID:
ENSDARG00000054534
Description:
acyl-CoA thioesterase 12 [Source:HGNC Symbol;Acc:24436]
Human Orthologue:
ACOT12
Human Description:
acyl-CoA thioesterase 12 [Source:HGNC Symbol;Acc:24436]
Mouse Orthologue:
Acot12
Mouse Description:
acyl-CoA thioesterase 12 Gene [Source:MGI Symbol;Acc:MGI:1921406]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9440 Essential Splice Site Available for shipment Available now
sa34983 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076731 Essential Splice Site 236 570 6 15
Genomic Location (Zv9):
Chromosome 10 (position 44279026)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43085052
GRCz11 10 42913432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGGRCAGATCATGGCCTGGATGGAGAATGTAGCTACAGTAGCAGCCAG[G/A]TATCAGATACACCTGCAARATGCATCATTAGCTGCACAACAACCCCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34983
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076731 Essential Splice Site 439 570 12 15
Genomic Location (Zv9):
Chromosome 10 (position 44275341)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43081367
GRCz11 10 42909747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGCTCGCCGACCTGCAGCTACGGCCACAGTGGGACAAAAACTACCTG[T/C]AGGAGAACAAGAGATTGCGGTTTATGAGTGCAAAAACACTTCAAATTGAG
Associated Phenotype:
Not determined