Busch Lab

ZMP

si:ch1073-98b4.1

Ensembl ID:
ENSDARG00000054448
ZFIN ID:
ZDB-GENE-090312-119
Human Orthologue:
KIF1C
Human Description:
kinesin family member 1C [Source:HGNC Symbol;Acc:6317]
Mouse Orthologues:
Gm1305, Kif1c
Mouse Descriptions:
kinesin family member 1C Gene [Source:MGI Symbol;Acc:MGI:1098260]
predicted gene 1305 Gene [Source:MGI Symbol;Acc:MGI:2686151]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8622 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37798 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17181 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8622
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076647 Essential Splice Site 36 240 None 7
ENSDART00000143054 Essential Splice Site 35 239 None 6
Genomic Location (Zv9):
Chromosome 23 (position 44793242)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44860691
GRCz11 23 44677211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACAACCATGATGCKAAATGTGTCATCCAGATGCAGGGAAACACCACCTG[T/A]GAGTGCACACACCRCATATGACAGTACATAATKTTTGACTGGATRTWCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37798
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076647 Essential Splice Site 136 240 5 7
ENSDART00000143054 None None 239 None 6
Genomic Location (Zv9):
Chromosome 23 (position 44786792)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44854241
GRCz11 23 44670761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTAGCTCAGACCGGGCTGGGTGCAGTAGGATCGATGGGTTATATATA[G/T]ATATCAGTCATTTTCTTTTCGGCTTGCAAACTCCACACAGAAAACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17181
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076647 Essential Splice Site 143 240 5 7
ENSDART00000143054 None None 239 None 6
Genomic Location (Zv9):
Chromosome 23 (position 44786769)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44854218
GRCz11 23 44670738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGTAGGATCGATGGGTTATATATANNGATATCAKTCATTTTCTWTTCGG[C/T]TTGCAAACTCCACACAGAAMACTGACCCAGYCGAGGCTYGAACCTGCAAC
Associated Phenotype:
Not determined