Busch Lab

ZMP

slc7a6

Ensembl ID:
ENSDARG00000054423
ZFIN ID:
ZDB-GENE-000607-21
Description:
Y+L amino acid transporter 2 [Source:UniProtKB/Swiss-Prot;Acc:Q59I64]
Human Orthologue:
SLC7A6
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a6
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31575 Essential Splice Site Available for shipment Available now
sa9302 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa965 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31575
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076615 Essential Splice Site 137 468 1 9
Genomic Location (Zv9):
Chromosome 7 (position 29977396)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28369919
GRCz11 7 28641112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGAGCCGCCGTATTCTGCGTCTCGGCTCATTGCTGCAGCTTGTATCTG[T/C]AAGTAAAATTCACAGGACATACCGTTGCTCTCCATGCTTGTTTTTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9302
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076615 Essential Splice Site 268 468 4 9
Genomic Location (Zv9):
Chromosome 7 (position 29972570)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28365093
GRCz11 7 28636286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCTGTGCTCGACATGAGTGCCATCCTTGCYAGTGATGCTGTCGCTGTG[G/A]TGAGTTCATGTTACCGGCTTTGTTCTATTCAGWAGRGYTTATCTCTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa965
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076615 Essential Splice Site 447 468 9 9
Genomic Location (Zv9):
Chromosome 7 (position 29962395)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28354918
GRCz11 7 28626111
KASP Assay ID:
554-0870.1 (used for ordering genotyping assays)
KASP Sequence:
ACCTAAAAATGTTAGTGGTCATTTTTTTTTTAAACATGTCTCTGTCCCGC[A/T]GGTGCCATCACCCGTTTCACCCAGTTCACCTGCTTTTGTGTGCTCACCGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461