Busch Lab

ZMP

stk33

Ensembl ID:
ENSDARG00000054318
ZFIN ID:
ZDB-GENE-040724-242
Description:
serine/threonine-protein kinase 33 [Source:RefSeq peptide;Acc:NP_001038554]
Human Orthologue:
STK33
Human Description:
serine/threonine kinase 33 [Source:HGNC Symbol;Acc:14568]
Mouse Orthologue:
Stk33
Mouse Description:
serine/threonine kinase 33 Gene [Source:MGI Symbol;Acc:MGI:2152419]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20953 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20953
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076496 Essential Splice Site 248 500 10 14
ENSDART00000100646 Essential Splice Site 248 500 9 13
ENSDART00000144896 None None 73 None 3

The following transcripts of ENSDARG00000054318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29715219)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28107742
GRCz11 7 28378935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACACATTTAATAGTGAAATGTGCATAAAGTGTGTGTGTCCCTATTTTC[A/T]GGTTGTGTGGAGAGCCTCCTTTTGGATCTAGCTCTAAGGAGAGGCTTTCT
Associated Phenotype:
Not determined