Busch Lab

ZMP

slc38a6

Ensembl ID:
ENSDARG00000054312
ZFIN ID:
ZDB-GENE-050522-51
Description:
Probable sodium-coupled neutral amino acid transporter 6 [Source:UniProtKB/Swiss-Prot;Acc:Q503G8]
Human Orthologue:
SLC38A6
Human Description:
solute carrier family 38, member 6 [Source:HGNC Symbol;Acc:19863]
Mouse Orthologue:
Slc38a6
Mouse Description:
solute carrier family 38, member 6 Gene [Source:MGI Symbol;Acc:MGI:3648156]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22337 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22337
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076479 Nonsense 243 449 11 16
Genomic Location (Zv9):
Chromosome 13 (position 31923840)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31569788
GRCz11 13 31700238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTCAGGAGGGTGAGAAATGACTGCGTGTGTGCATTACAGAGCGCGTA[T/A]GCCGTCCCAACAATGGCTTTCTCCTTCCTGTGCCATACAGCAGTTTTACC
Associated Phenotype:
Not determined