Busch Lab

ZMP

acin1a

Ensembl ID:
ENSDARG00000054290
ZFIN ID:
ZDB-GENE-030616-583
Description:
apoptotic chromatin condensation inducer 1a [Source:RefSeq peptide;Acc:NP_001007106]
Human Orthologue:
ACIN1
Human Description:
apoptotic chromatin condensation inducer 1 [Source:HGNC Symbol;Acc:17066]
Mouse Orthologue:
Acin1
Mouse Description:
apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa19828 Essential Splice Site, Missense Available for shipment Available now
sa32981 Nonsense Mutation detected in F1 DNA Not yet available
sa12080 Nonsense Available for shipment Available now
sa32980 Nonsense Mutation detected in F1 DNA Not yet available
sa44541 Nonsense Mutation detected in F1 DNA Not yet available
sa16806 Nonsense Available for shipment Available now
sa39892 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18032 Essential Splice Site Available for shipment Available now
sa25870 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19828
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Missense 225 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 Essential Splice Site 224 857 5 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37919112)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38234026
GRCz11 2 38216354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCCAGACCTCAACGGAGTCGTCGAGCACAGCCGCCAAAAAGTCAACCG[G/A]TGAGGACAAGATCCAGTGGCTCGCAGCAACAGCAGCAGCCACCCCCCCAA
Long Flanking Sequence:
CAACATGGTAAACCGTGACAATGCTGACTGTTGAATTGATTTAAATAAATATAAATACTTGGCAGCAATGTATTAGCAATATTGCGATAAATCGTCATATCAATATTTTGTCCCACCACTAGTATGAATTTGTGTTTGTTTATATATTTCTCTGGTTATGAATTCATTACTAAGTTGTCTTTAATCTCATATTTTTCCGCTAGGATGTTGCTTCTTCCTTAGTCGATCAGAACCAGGGAAGTGCAGCAGTTGCTGGGGGATTTGGGGTCACAGAAAGCGAAAGTGAAAAAGAAATGCCTGGACAACCGTCCCTTTCTACAGCTGCCCATTCCCGTCCAAGAGCTTCATCTGTGCGGCTTCGTGGTAAAGGAGAGCCGACTTCAAGTCATGTACCAGCAGAAAGTGATGATGACAGTGAAGCTGGGGATGATGAGGAGGAGGAGGAGTGGAACGCCAGACCTCAACGGAGTCGTCGAGCACAGCCGCCAAAAAGTCAACCG[G/A]TGAGGACAAGATCCAGTGGCTCGCAGCAACAGCAGCAGCCACCCCCCCAACACATACCTTTACTGTCACAGCAGCTCAGACATCCAACTCCTCCCCCATCCCCTCCTCCTGAACTTTCTTTCCCACTCCCAGACACCCCTAAACAGAGTCCTCCTAGTCCTGGAGAGTCCCCGTCTAGGCAGCGTATATCTAGCTCTTCGAGTTCTGGTAGTTCCAGTAGTGACAGTCGTAGCAGTAGTCCTGAACCAGCAAGTGACACCACAGAACGCAGACCAGGTCCGTTAACCTTACTGGCACGCAAGATGGCATCTGAGAGGGCTTGTTCTGGAGCAGGAAAGCGTGATAGGGAAGGAGTGGATTTACAAAGAAGCCACCAAGAGGGAGTTGTATCCGCAATTACACACACAGCCAATGCAGCATCAGTTCTCTCACACCCTAGTTCAGTCATCTCCAACCAAGGTGTTAGTGTCGTTAGAGCCGCTGTGATGGAAGCGAGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32981
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 235 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37919082)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233996
GRCz11 2 38216324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCGCCAAAAAGTCAACCGGTGAGGACAAGATCCAGTGGCTCGCAGCAA[C/T]AGCAGCAGCCACCCCCCCAACACATACCTTTACTGTCACAGCAGCTCAGA
Long Flanking Sequence:
TTGAATTGATTTAAATAAATATAAATACTTGGCAGCAATGTATTAGCAATATTGCGATAAATCGTCATATCAATATTTTGTCCCACCACTAGTATGAATTTGTGTTTGTTTATATATTTCTCTGGTTATGAATTCATTACTAAGTTGTCTTTAATCTCATATTTTTCCGCTAGGATGTTGCTTCTTCCTTAGTCGATCAGAACCAGGGAAGTGCAGCAGTTGCTGGGGGATTTGGGGTCACAGAAAGCGAAAGTGAAAAAGAAATGCCTGGACAACCGTCCCTTTCTACAGCTGCCCATTCCCGTCCAAGAGCTTCATCTGTGCGGCTTCGTGGTAAAGGAGAGCCGACTTCAAGTCATGTACCAGCAGAAAGTGATGATGACAGTGAAGCTGGGGATGATGAGGAGGAGGAGGAGTGGAACGCCAGACCTCAACGGAGTCGTCGAGCACAGCCGCCAAAAAGTCAACCGGTGAGGACAAGATCCAGTGGCTCGCAGCAA[C/T]AGCAGCAGCCACCCCCCCAACACATACCTTTACTGTCACAGCAGCTCAGACATCCAACTCCTCCCCCATCCCCTCCTCCTGAACTTTCTTTCCCACTCCCAGACACCCCTAAACAGAGTCCTCCTAGTCCTGGAGAGTCCCCGTCTAGGCAGCGTATATCTAGCTCTTCGAGTTCTGGTAGTTCCAGTAGTGACAGTCGTAGCAGTAGTCCTGAACCAGCAAGTGACACCACAGAACGCAGACCAGGTCCGTTAACCTTACTGGCACGCAAGATGGCATCTGAGAGGGCTTGTTCTGGAGCAGGAAAGCGTGATAGGGAAGGAGTGGATTTACAAAGAAGCCACCAAGAGGGAGTTGTATCCGCAATTACACACACAGCCAATGCAGCATCAGTTCTCTCACACCCTAGTTCAGTCATCTCCAACCAAGGTGTTAGTGTCGTTAGAGCCGCTGTGATGGAAGCGAGCGATGGCATAAAGCAGGATGAAGGTGTTTTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12080
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 473 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918368)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233282
GRCz11 2 38215610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAA[C/T]GACTCGAAYGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAA
Long Flanking Sequence:
AACCAGCAAGTGACACCACAGAACGCAGACCAGGTCCGTTAACCTTACTGGCACGCAAGATGGCATCTGAGAGGGCTTGTTCTGGAGCAGGAAAGCGTGATAGGGAAGGAGTGGATTTACAAAGAAGCCACCAAGAGGGAGTTGTATCCGCAATTACACACACAGCCAATGCAGCATCAGTTCTCTCACACCCTAGTTCAGTCATCTCCAACCAAGGTGTTAGTGTCGTTAGAGCCGCTGTGATGGAAGCGAGCGATGGCATAAAGCAGGATGAAGGTGTTTTATGGGAGCAAGAACAAGAGAGGCTGAAAGCCCTAGAGAAAGAGGAGGAGGAAAGGGAGAAGGCATTGGAAAAGGAGCGAGCACAAGCTTTGGAACGGAAAAGACTTGAAGCTGCTTCGAAACGTGAGAAGGAGAGGGCTTTACAGCGAGAAAGGGAAGAGAAGGAGAGACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAA[C/T]GACTCGAACGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAGCAAGCTTTAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAACGAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAGGAAAGACAAGAACGAGAAGAAGCTCTAGAAAAGGAGAGATTGGAGAGAGAGCGGCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAGGAAGCTCAAGAGAGGGAGAGATTGAAGAAAGAGCGTCTTGAGAAAGAAAAAAAAGAAGCTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5158
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 476 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918359)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233273
GRCz11 2 38215601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAACGACTCGAA[C/T]GAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAG
Long Flanking Sequence:
GTGACACCACAGAACGCAGACCAGGTCCGTTAACCTTACTGGCACGCAAGATGGCATCTGAGAGGGCTTGTTCTGGAGCAGGAAAGCGTGATAGGGAAGGAGTGGATTTACAAAGAAGCCACCAAGAGGGAGTTGTATCCGCAATTACACACACAGCCAATGCAGCATCAGTTCTCTCACACCCTAGTTCAGTCATCTCCAACCAAGGTGTTAGTGTCGTTAGAGCCGCTGTGATGGAAGCGAGCGATGGCATAAAGCAGGATGAAGGTGTTTTATGGGAGCAAGAACAAGAGAGGCTGAAAGCCCTAGAGAAAGAGGAGGAGGAAAGGGAGAAGGCATTGGAAAAGGAGCGAGCACAAGCTTTGGAACGGAAAAGACTTGAAGCTGCTTCGAAACGTGAGAAGGAGAGGGCTTTACAGCGAGAAAGGGAAGAGAAGGAGAGACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAACGACTCGAA[C/T]GAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAGCAAGCTTTAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAACGAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAGGAAAGACAAGAACGAGAAGAAGCTCTAGAAAAGGAGAGATTGGAGAGAGAGCGGCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAGGAAGCTCAAGAGAGGGAGAGATTGAAGAAAGAGCGTCTTGAGAAAGAAAAAAAAGAAGCTCTTGAGAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32980
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 512 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918251)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233165
GRCz11 2 38215493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAA[C/T]GAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAG
Long Flanking Sequence:
TACAAAGAAGCCACCAAGAGGGAGTTGTATCCGCAATTACACACACAGCCAATGCAGCATCAGTTCTCTCACACCCTAGTTCAGTCATCTCCAACCAAGGTGTTAGTGTCGTTAGAGCCGCTGTGATGGAAGCGAGCGATGGCATAAAGCAGGATGAAGGTGTTTTATGGGAGCAAGAACAAGAGAGGCTGAAAGCCCTAGAGAAAGAGGAGGAGGAAAGGGAGAAGGCATTGGAAAAGGAGCGAGCACAAGCTTTGGAACGGAAAAGACTTGAAGCTGCTTCGAAACGTGAGAAGGAGAGGGCTTTACAGCGAGAAAGGGAAGAGAAGGAGAGACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAACGACTCGAACGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAGCAAGCTTTAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAA[C/T]GAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAGGAAAGACAAGAACGAGAAGAAGCTCTAGAAAAGGAGAGATTGGAGAGAGAGCGGCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAGGAAGCTCAAGAGAGGGAGAGATTGAAGAAAGAGCGTCTTGAGAAAGAAAAAAAAGAAGCTCTTGAGAAAGAGCGCCTTGAGAAGGAAAGACAAGAAAAAGAAGCTGTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAAGCTGCTCTAGAAAGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44541
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 533 630 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918188)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233102
GRCz11 2 38215430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAGGAAAGACAAGAA[C/T]GAGAAGAAGCTCTAGAAAAGGAGAGATTGGAGAGAGAGCGGCTTGAGAAG
Long Flanking Sequence:
TTCTCTCACACCCTAGTTCAGTCATCTCCAACCAAGGTGTTAGTGTCGTTAGAGCCGCTGTGATGGAAGCGAGCGATGGCATAAAGCAGGATGAAGGTGTTTTATGGGAGCAAGAACAAGAGAGGCTGAAAGCCCTAGAGAAAGAGGAGGAGGAAAGGGAGAAGGCATTGGAAAAGGAGCGAGCACAAGCTTTGGAACGGAAAAGACTTGAAGCTGCTTCGAAACGTGAGAAGGAGAGGGCTTTACAGCGAGAAAGGGAAGAGAAGGAGAGACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAACGACTCGAACGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAGCAAGCTTTAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAACGAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAGGAAAGACAAGAA[C/T]GAGAAGAAGCTCTAGAAAAGGAGAGATTGGAGAGAGAGCGGCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAGGAAGCTCAAGAGAGGGAGAGATTGAAGAAAGAGCGTCTTGAGAAAGAAAAAAAAGAAGCTCTTGAGAAAGAGCGCCTTGAGAAGGAAAGACAAGAAAAAGAAGCTGTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16806
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 563 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918097)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233011
GRCz11 2 38215339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGAT[T/A]GGAGAAAGARCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAG
Long Flanking Sequence:
TGAAGGTGTTTTATGGGAGCAAGAACAAGAGAGGCTGAAAGCCCTAGAGAAAGAGGAGGAGGAAAGGGAGAAGGCATTGGAAAAGGAGCGAGCACAAGCTTTGGAACGGAAAAGACTTGAAGCTGCTTCGAAACGTGAGAAGGAGAGGGCTTTACAGCGAGAAAGGGAAGAGAAGGAGAGACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAACGACTCGAACGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAGCAAGCTTTAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAACGAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAGGAAAGACAAGAACGAGAAGAAGCTCTAGAAAAGGAGAGATTGGAGAGAGAGCGGCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGAT[T/A]GGAGAAAGAGCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAGGAAGCTCAAGAGAGGGAGAGATTGAAGAAAGAGCGTCTTGAGAAAGAAAAAAAAGAAGCTCTTGAGAAAGAGCGCCTTGAGAAGGAAAGACAAGAAAAAGAAGCTGTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGGAAAAAAGAGAAAAAGAAGCTGCTCTAGAAAGGGAGAGATTGGAAAAAGAGCGTATTGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTGGAGAAGGAAAAAAGAGAAAAAGAAGAAGCTCTAGAGAGGGAGAGATTGGAGAAAGAGCGTCTTGAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39892
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 None None 631 None 5
ENSDART00000076459 Essential Splice Site 307 548 9 12
ENSDART00000128043 Essential Splice Site 616 857 15 18
ENSDART00000136082 Essential Splice Site 331 572 9 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 Essential Splice Site 307 548 9 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37903290)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38218204
GRCz11 2 38200532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGAGTAACCCTAAATTCCTCAGTGTTGACTTCTGTACGCAAGATGAGG[T/G]AAGCATTTCGTTTGATGGTATAGGATATTAGGTTTAAATCTTTTCCACAG
Long Flanking Sequence:
CTCGTGGCAAGCTGTCTAATATCGTCCATGTCTGCAACCTGGTATATATACACTCACACACAATGTTTCAGATATGCTAATTGCATAGACATTTCAGCTGCGCTTATAAAGACAATCCATTTGCAGTCTTAAAATGATTTATTCTCTTGGGATGGTTGATCTCAGACTTGATTTGTGATGTTTCTAAGGTGAGGCCATTCACCCTGGGTCAGTTAAAGGAGCTGTTGAACCGCACAGGAACTGTAGTGGAGGAAAGTTTCTGGATTGACAAGATTAAATCTCACTGTTATGTCACAGTAAGCTTCTTCCCTGCATTTCCAAGTATCTTTTATTCAGATTTTTAAATACATTTATTGTTGCTCACCCACTCACTGTCTTTGCTTTTCTTTAGTACTCTAGTGCAGAAGAGGCTATGGCCACGCGTACAGCACTGCATGGTGTAAAATGGCCCCAGAGTAACCCTAAATTCCTCAGTGTTGACTTCTGTACGCAAGATGAGG[T/G]AAGCATTTCGTTTGATGGTATAGGATATTAGGTTTAAATCTTTTCCACAGTCTTTTTATTCCTTTGGAAACTAATTCTGCGTCATCCCATTAGTTGGACTTCCACAGGGGTTTGGGTCCAGCAGGAGAAAAGCCACCAGAGGATGCCCGTGGGGCTGCAGCTGCTGGGCCTGGCCGTCCTATGCCAGTGCCGCTCCTGCCAGAGCGTGACCAGTGGGCAGAACGTGAACGGGAAATGGAAAGGCGAGAGAGAGCACGTGCAGAAAGAGAGTGGGACAGAGATAAGGTCAGAGACTTCAGCAAACCTGGAGAGGACCGGGAACCTGGAGCCAGAAGATCACGCTCACGAGATCGTGAAAGGCGGCGTAAAGAAAGGGGGAAGAGCAAAGAGAGGAAAGCTGATAAAAAGGGTAAGGAAAAATTTAATGTACATGGACTACTTTTGTGCATTGGAGTAATGTTGTTTTTGGGATTATTGTAGTTTTTTATTGTATTGCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18032
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 None None 631 None 5
ENSDART00000076459 Essential Splice Site 413 548 10 12
ENSDART00000128043 Essential Splice Site 722 857 16 18
ENSDART00000136082 Essential Splice Site 437 572 10 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 Essential Splice Site 413 548 10 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37902879)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38217793
GRCz11 2 38200121
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGCGTAAAGARAGGGGGAAGAGCAAAGAGAGGAAAGCTGATAAAAAGGG[T/G]AAGGAAAAWTTTAATGTACAYGGACTACTTTTGTGCATTGGAGTAATGTT
Long Flanking Sequence:
TATGGCCACGCGTACAGCACTGCATGGTGTAAAATGGCCCCAGAGTAACCCTAAATTCCTCAGTGTTGACTTCTGTACGCAAGATGAGGTAAGCATTTCGTTTGATGGTATAGGATATTAGGTTTAAATCTTTTCCACAGTCTTTTTATTCCTTTGGAAACTAATTCTGCGTCATCCCATTAGTTGGACTTCCACAGGGGTTTGGGTCCAGCAGGAGAAAAGCCACCAGAGGATGCCCGTGGGGCTGCAGCTGCTGGGCCTGGCCGTCCTATGCCAGTGCCGCTCCTGCCAGAGCGTGACCAGTGGGCAGAACGTGAACGGGAAATGGAAAGGCGAGAGAGAGCACGTGCAGAAAGAGAGTGGGACAGAGATAAGGTCAGAGACTTCAGCAAACCTGGAGAGGACCGGGAACCTGGAGCCAGAAGATCACGCTCACGAGATCGTGAAAGGCGGCGTAAAGAAAGGGGGAAGAGCAAAGAGAGGAAAGCTGATAAAAAGGG[T/G]AAGGAAAAATTTAATGTACATGGACTACTTTTGTGCATTGGAGTAATGTTGTTTTTGGGATTATTGTAGTTTTTTATTGTATTGCTATACATGGCTTTGTTTTGGTCAAATGTATTTGTAAGTTTGTTCTTAATGCAATTATTTTATATAATTGCTGTATTAATTAAATGTCTGTTGGAATATTATGATAGTTTTGTATATTTTTGCATTGAAAAAACATGACGTGTGTATTTTGTGTTTTTACTTTTATTATTCCAGTGCTGCCGTAAACACAAAGGGATGTAAACACAAAAGCATTTTATTTTTAAAATTAAATTTTATTAACTTCCTCCCTCTTCCTTTTTAGAAAAAGGGCCCGAGGAGCCACCTGCTAAACTTCTGGATGACCTCTTCCGTAAAACCAAAGCTGCTCCGTGTATATACTGGCTCCCCCTCACTGAGGAGCAGGTACAGTTCTTTGGACATTTTAGTTATTTAGGCCCAATCCCAATTCTATTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25871
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 None None 631 None 5
ENSDART00000076459 Essential Splice Site 446 548 11 12
ENSDART00000128043 Essential Splice Site 755 857 17 18
ENSDART00000136082 Essential Splice Site 470 572 11 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 Essential Splice Site 446 548 11 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37902430)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38217344
GRCz11 2 38199672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCAAAGCTGCTCCGTGTATATACTGGCTCCCCCTCACTGAGGAGCAGG[T/G]ACAGTTCTTTGGACATTTTAGTTATTTAGGCCCAATCCCAATTCTATTTT
Long Flanking Sequence:
GCGGCGTAAAGAAAGGGGGAAGAGCAAAGAGAGGAAAGCTGATAAAAAGGGTAAGGAAAAATTTAATGTACATGGACTACTTTTGTGCATTGGAGTAATGTTGTTTTTGGGATTATTGTAGTTTTTTATTGTATTGCTATACATGGCTTTGTTTTGGTCAAATGTATTTGTAAGTTTGTTCTTAATGCAATTATTTTATATAATTGCTGTATTAATTAAATGTCTGTTGGAATATTATGATAGTTTTGTATATTTTTGCATTGAAAAAACATGACGTGTGTATTTTGTGTTTTTACTTTTATTATTCCAGTGCTGCCGTAAACACAAAGGGATGTAAACACAAAAGCATTTTATTTTTAAAATTAAATTTTATTAACTTCCTCCCTCTTCCTTTTTAGAAAAAGGGCCCGAGGAGCCACCTGCTAAACTTCTGGATGACCTCTTCCGTAAAACCAAAGCTGCTCCGTGTATATACTGGCTCCCCCTCACTGAGGAGCAGG[T/G]ACAGTTCTTTGGACATTTTAGTTATTTAGGCCCAATCCCAATTCTATTTTTGTATCCCTACCCATTCCCCTTCCCCCTTGGCCCTTGAAGCACAGTGTGAACACAGGCTTCAAAATGTACTCCTAAGAAATGGGACCGCACTACAACACCTGCACATGGCATCTTATATCATCCTAATCTCTTGCATCATATGACATCGACGATCGCAACTGCTGAAGTTATTGAAATTGTTATATTTTGTTATTTATCTTCAGGTACTCACTGAAAGCAACGATATCCTGTTATCCGAACAATATAAATCAGCAATAACTCGTAACTGTACTGTATTTAACCCGTGGCCATATTAATCTATGTAAATGCACAAAAACAACAAACATTACAGCAGACTTTGTAAACAATTTATTATCAGCCACCGGACTATTCTGACAGGATTTAAGTGTCATGAAGTGAAAGTATGTTGTGGGACTGCTATACATGAGTTATTATTGTGGATTATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 None None 631 None 5
ENSDART00000076459 Nonsense 502 548 12 12
ENSDART00000128043 Nonsense 811 857 18 18
ENSDART00000136082 Nonsense 526 572 12 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 Nonsense 502 548 12 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37901381)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38216295
GRCz11 2 38198623
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCAGCGGAACTGCTGGAGGAGAAGGTGAGAGGGGCCGAGACAGAGAA[C/T]GAGAGCGAGACAGGGGTCGAGAAAGAGAGCGCGAGGGGGACAAGCGGAAA
Long Flanking Sequence:
TGAGCATGATAAAAACATGAACATGGTTATGAATGTATTAAAACGTGCTTGTTTTTTTTTTATAAAAAATGCATTATAGTGACAAAAAATACTAGTGCAGCCATGCTGCTGTTTTAATCTTCATACCCCTTGGTTTCAAGTGTGGTCTTGAAAAATCTCAATTTCAAGAGCTATCTAGTGTTTCCCATTAGCCCAACGCCTTCAAGCTAAAGAGAATTGGGACACCCCTACCCCTTCGCATGAATGCGCAAAATGAGGGGTAAGGGGTAGAATTGGGATTGAGCCTTTTGTTTGCTGAATAAAATATTAATCTCCTATCACACTTTGCATTGCAGGCAGCACAGAGGGCAGCGGCTCGTGCAGAGCGCATGAGAGAACGAGAGAAGAGGATAAAGGAGATGGAAGAGGAGGAGGGTAAGAAACGTGAGGAGGAACGGCGGGAGAGGATGAAACCCAGCGGAACTGCTGGAGGAGAAGGTGAGAGGGGCCGAGACAGAGAA[C/T]GAGAGCGAGACAGGGGTCGAGAAAGAGAGCGCGAGGGGGACAAGCGGAAAGAGGGATACCGTAGGCCTGGGGTAAACAGTGCGAGCGGCAGCAGAAGGTCACGGAGCCGCAGTGACCCTCCACCCAGAGATCGACGGCGCTAAAGGACGTCTGGAACTGTCCAGTTTGTATCCCCTTTTCTTGTATGTGCTGTAACAGCTCTATGCCTACCCTCCTGAGGACCAACTCAGACTTCATACAAACACACATGTGCGTGCACACACTCTGCGTAAAGACACACAGGTGCACACACACACTCACTCTCAATGGGACCACGGTGGTGCTGTGTCTCCATGTAGACTTGTCTCGTTGTTTCTTGACTTGGCTTTAAGACTTCTGGTATTCATTTCCCCTTCTCAGTGTTAATGAGCGTCCAGTATAAGTGGCTCGGATTGCAAGATTACATCCAGGTTTGGCAACATCCTCTTTCTCCTCTTGTGTCACGTCGACACTCATCTGAA
Associated Phenotype:
Not determined