Busch Lab

ZMP

zgc:136860

Ensembl ID:
ENSDARG00000054264
ZFIN ID:
ZDB-GENE-060312-33
Description:
conserved oligomeric Golgi complex subunit 4 [Source:RefSeq peptide;Acc:NP_001034912]
Human Orthologue:
COG4
Human Description:
component of oligomeric golgi complex 4 [Source:HGNC Symbol;Acc:18620]
Mouse Orthologue:
Cog4
Mouse Description:
component of oligomeric golgi complex 4 Gene [Source:MGI Symbol;Acc:MGI:2142808]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44664 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2406
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076425 Essential Splice Site 45 781 1 19
ENSDART00000135498 Essential Splice Site 45 601 1 14
Genomic Location (Zv9):
Chromosome 7 (position 30360945)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28753287
GRCz11 7 29024437
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGCTGGAGGATCTGGAGCGGGTCTACGCGCAGCTGTGTGCCGAAGAGG[T/G]AAATATTTACCAGTGGAAAAAGGGTGTGCTCGTTACTTCAGGGACTACTA
Long Flanking Sequence:
GCTGAAGGAATGCTCACAAATGGCTGATTTCTCTCAGACGGTCTAACTGAAAGTTGTAGTATAGTATACTTTAGCTTATTCCTAACTTAAATGGAGTCTTGCAGCTGCCCCACTCTCCCCTAAATGATACAACAAACGGAAAAAGAAAGAAAACGTTAATAAAAATAGTTTTACTACGTTAGTTGTAGATTAATGGTTGCGACAGCTTTTGTCATTTTTTGTCATAGATTTTGACATCTATTTAACTCAGTTGCCTTAAGAAAAACCTACCACTAGGTGGGAGTAACGTCGCATATTAGCTACAGTTGTATGACGCGTTGCTACTCAACGGAAGTGACGCAGTTTGTGTGTATGTGGGGCTGTCATGGAAGAAGCAGCTTCACCGGCTCGTCGTCGCGGTGGTCCGGCGGGGGTCTCCGCCGTGCAGACCGACACTATCGAGGCTCTAACTGAGCTGGAGGATCTGGAGCGGGTCTACGCGCAGCTGTGTGCCGAAGAGG[T/G]AAATATTTACCAGTGGAAAAAGGGTGTGCTCGTTACTTCAGGGACTACTATGAAAACTCTTATCATGTGTTCTAGATAGTGTTTGACATTTAAAAAAGATTGTGTGCGTCAACAATGAGATTTGGAGTGTTGACATACGCTGGCATGAACTGTAAACAAACGCACCTCTCTGACAGGCGGAAGTGCAGGTGGAGTTGGACGCTCTTGTGGGACAACAGAACAACATCGAAACAAAGATGCTCTCCCTGCAGAGGATGGGGTGAGTGCTTTTGATTACAGCTAACCTAACGTTTCACCACAACAGGTGTCCTGACATTTTATCTTACCCATCAGAATTATGCTACCAACACAGTATTTGAATGGTTCTGATGTTGGGGTAAGGGATTAGGTAGGTTAGGGCGATATTACAACTTCATATCACACTGCTCCGCATTAAAAATCTGGTAGCAAAATCTGATGGTCATCGAAATGTGCTACTTACTTTTTGAATGGGACGTAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2368
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076425 Nonsense 411 781 10 19
ENSDART00000135498 Nonsense 411 601 10 14
Genomic Location (Zv9):
Chromosome 7 (position 30369239)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28761581
GRCz11 7 29032731
KASP Assay ID:
554-2965.1 (used for ordering genotyping assays)
KASP Sequence:
TTACTGAAGAATTGCCAGCTGAGTCGCACTATGCAGGAGCTGATTGGCTA[T/G]TACATTCCTATGGAGGAGTATTACATGAGAGAGTCTGTCAACAAGGTGCT
Long Flanking Sequence:
TCTCTAAGCATTTATGAATTTCTTGCCATGAATTTTAAACATTTCCAGAGTATGTGTGTATAATTCGCTTCATTTGAGCCGCATAGTCTCCAACAGACTGCATTTTTGTTTAGTATCTCTTCTGCTCAGGGCTGACATATTTTTTGTATTTCATGTACAGAATGTGTTCGTATTTATACATATATATTCACAGTGTGCACGTAAATAATATGTAAACCTTTACTTCACTAGTTTGACAGCACATATATTGAATAACACAGCCAGATTTAATTGTAATACTCTTGTTGGCTACACAAACTAGACATGACTGCAAAAAAACAGTGCTCAATGCATCCACTGATTTATGCTTATTATTACTTCGGTGGAATTTCAGTTTAACAACATTTGCTTGTATTGTTTATTGTTGTTTGACTTTTTTTATTTCTAGAGCATCAGCAGAGTTTAGAACAGTTACTGAAGAATTGCCAGCTGAGTCGCACTATGCAGGAGCTGATTGGCTA[T/G]TACATTCCTATGGAGGAGTATTACATGAGAGAGTCTGTCAACAAGGTGCTTCGTGTATTCAGTATATAAATCTAGACTTTCATGTGTGAATGTACATTATACTCCAGTTACGAATGTTAACCGTTCAAATGTTTGGAATTTGTCAGTTGTTTTTAAAATGCAAAGAAGCAGGAAAGTAATATTTAAATAGAGATACATTAAAATACAATGATGGTAAAGAAATTACCAGTGTTACTATTAAATATTTTTCAAGTAAAAAAATTTTGTATAATATTCATTTATTAAAGTGGTATCATGATTTTTACAAATCTTTTAGGCTGCACAATACTTTTCAGTTGTGATGATACTTTCCAAAGCTCCAAATCACCATGATTTGTTTAGGATTGTTTGACTATTGGAGATAATGTTATGCAATCATAGAAAAACATTATAAAGTAAAATATATTCTAATTAAAAACAGCTAAATTGTTGTTTAAATAAATGCTAACCCTGATGAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44664
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076425 Nonsense 615 781 15 19
ENSDART00000135498 None None 601 None 14
Genomic Location (Zv9):
Chromosome 7 (position 30374757)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28767099
GRCz11 7 29038249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATGTACAGGAGGGTCTACAGGAGCTTAACAACACTGCTATCAGGCCA[C/T]AAGTAAAGCCCTGGATCAGCAGCTTCCTGTCTGTCTCGCACAATATTGAA
Long Flanking Sequence:
ATACTTTGGGAATTGCTTGGATCATCAACATGATTGTACACGACGGGAAGAAAAGTAGTTTTAAGGGGGGAGGGATGGTTACAATACTTCATTAAAGGTCATGGGGGCACATGAATTTATTCATAATATTGAAGTGCACACATTAATCATCACATATGACGTGTGGAGCTGCACATCGATGGATTTGCTCTTCAGTGTTTGGACTTTCAGCAGTGAAAATTAAACCACACTAAACTGAACTTCAACTCTGAAAACTGGACTAACATTTTCAATTTACTAGAACTTCTATATTAAGCTGCTTTGACACAATCTACATTGTAATAGGGCTATAGAAATAAAGATGAATTGAATTGAACATATAACACTACACTAGAAATAATCGTTGTAAATTTTAACTTTATGACCACTTTAAAAGGCAAGATGATCTTGTTTGTTTGTGCTAATGGTTTGTATATGTACAGGAGGGTCTACAGGAGCTTAACAACACTGCTATCAGGCCA[C/T]AAGTAAAGCCCTGGATCAGCAGCTTCCTGTCTGTCTCGCACAATATTGAAGAGGTATGTGATAACAATACCATACCTGCTATTTGACAGAGTGAAAGCACATGTCTTCACCATTGACAATAACAGCAATGGAAATATTAACAGTACCTTCAATCATAAAGTTTTGTGTTATTTTTTTTTATCTTAGGAAGAGTTTAGTGAGTATGAAGCCAATGATCCCTTTGTTCAGCAACTCATTGTCCAGTTGGAGCAGCTTATGGCTGAGTTTAAGGTATATAATGTTTAATACACACATCTATTCATAAACACACATGCATACAAACCCGTTTATTAAACGTTTCTCAATAGGTCGGACTGTCACCGGTCATCTATGATACTCTGACTAGCCTGATGACCAGCCTAATTGCAATGGAGATGGAGAAGACTGTGTTCAAATGCACCTTCAGCAGGGTAAGTGGGAACCAACCTGCGTATAACATCTTAATTGCTTGAAATCACAGA
Associated Phenotype:
Not determined