Busch Lab

ZMP

zgc:91897

Ensembl ID:
ENSDARG00000054224
ZFIN ID:
ZDB-GENE-040711-1
Description:
importin-11 isoform 1 [Source:RefSeq peptide;Acc:NP_001153133]
Human Orthologue:
IPO11
Human Description:
importin 11 [Source:HGNC Symbol;Acc:20628]
Mouse Orthologue:
Ipo11
Mouse Description:
importin 11 Gene [Source:MGI Symbol;Acc:MGI:2442377]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2457 Nonsense F2 line generated Not yet available
sa34440 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5490
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045295 Essential Splice Site 80 975 2 29
ENSDART00000133245 None None 85 None 3
ENSDART00000138268 Essential Splice Site 80 543 3 17
ENSDART00000145325 Essential Splice Site 80 961 2 29
Genomic Location (Zv9):
Chromosome 8 (position 33175204)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32317930
GRCz11 8 32327162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTATTTCAAGAATGGTATCGATCGCTACTGGAGAAGAGTCGCACCCCAG[T/A]AAGTACATCAGATTCTTTATCACCATCTCTAGACTTTTCTATCAAGCYRG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2457
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045295 Nonsense 108 975 4 29
ENSDART00000133245 None None 85 None 3
ENSDART00000138268 Nonsense 108 543 5 17
ENSDART00000145325 Nonsense 108 961 4 29
Genomic Location (Zv9):
Chromosome 8 (position 33167499)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32310225
GRCz11 8 32319457
KASP Assay ID:
554-3300.1 (used for ordering genotyping assays)
KASP Sequence:
GAAATCCCTGTAAACTTTTTTTTTTTCTTTTTTGAATGCAGATCGCCACA[C/T]AGATAGCAGTGCTGATCGCWAAAGTGGCACGTCTGGACTGTCCTCGGCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3665
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045295 Essential Splice Site 723 975 22 29
ENSDART00000133245 None None 85 None 3
ENSDART00000138268 None None 543 None 17
ENSDART00000145325 Essential Splice Site 709 961 22 29
Genomic Location (Zv9):
Chromosome 8 (position 32977236)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32119962
GRCz11 8 32129194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAGATCATCAATGCCTACATTTATCTCTCAGCTACAGATTTCTTACAG[G/A]TAGGCACAAAAAAAAATKACTTCAAATAACTAGACATTCAAAGAAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34440
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045295 Nonsense 749 975 23 29
ENSDART00000133245 None None 85 None 3
ENSDART00000138268 None None 543 None 17
ENSDART00000145325 Nonsense 735 961 23 29
Genomic Location (Zv9):
Chromosome 8 (position 32973844)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32116570
GRCz11 8 32125802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTGAACTCCTGAGCGACATCACCAATGAAGGCCAGGTCCAGGTTT[T/A]GAAGGTACTGTATGACTCAATCTTTCACACTCTTTCTACTCACAGCCCGA
Associated Phenotype:
Not determined