Busch Lab

ZMP

rnf40

Ensembl ID:
ENSDARG00000054201
ZFIN ID:
ZDB-GENE-030131-6607
Description:
Novel protein (Zgc:171713) [Source:UniProtKB/TrEMBL;Acc:Q7T178]
Human Orthologue:
RNF40
Human Description:
ring finger protein 40 [Source:HGNC Symbol;Acc:16867]
Mouse Orthologue:
Rnf40
Mouse Description:
ring finger protein 40 Gene [Source:MGI Symbol;Acc:MGI:2142048]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35311 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27971
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076342 Nonsense 390 990 9 24
ENSDART00000076346 Nonsense 446 575 10 12
ENSDART00000076355 None None 558 None 17
ENSDART00000076572 None None 331 None 7
ENSDART00000137069 Nonsense 400 529 8 10
ENSDART00000145221 None None 429 None 8
Genomic Location (Zv9):
Chromosome 12 (position 30466875)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28803812
GRCz11 12 28918714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGATCTGAGGAATATCCCAGAGGAAGTGTTGAAGGAGACGCCAGAGTA[C/A]AAGTGCCTCCAGTCTCAGTTCTCTCTGCTGTATAATGAGTCTCTGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35311
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076342 Splice Site, Nonsense 898 990 22 24
ENSDART00000076346 None None 575 None 12
ENSDART00000076355 Splice Site, Nonsense 493 558 13 17
ENSDART00000076572 None None 331 None 7
ENSDART00000137069 None None 529 None 10
ENSDART00000145221 Splice Site, Nonsense 337 429 6 8
Genomic Location (Zv9):
Chromosome 12 (position 30478635)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28815572
GRCz11 12 28930474
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGACAACCGCACCGCCCGTGAGAGGGAGAGTGTCAACCTCAAGAAAGCA[C/T]AGGTACATGGGCATGCGTGTTGTAGATGTGTTTGGGATACAGATGAGTGG
Associated Phenotype:
Not determined