Busch Lab

ZMP

gpr126

Ensembl ID:
ENSDARG00000054137
ZFIN ID:
ZDB-GENE-041014-357
Description:
G-protein coupled receptor 126 [Source:UniProtKB/Swiss-Prot;Acc:C6KFA3]
Human Orthologue:
GPR126
Human Description:
G protein-coupled receptor 126 [Source:HGNC Symbol;Acc:13841]
Mouse Orthologue:
Gpr126
Mouse Description:
G protein-coupled receptor 126 Gene [Source:MGI Symbol;Acc:MGI:1916151]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25142 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4921
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076275 Essential Splice Site 730 1227 10 20
ENSDART00000125854 Essential Splice Site 743 1185 14 24
ENSDART00000128321 Essential Splice Site 833 1275 20 31
ENSDART00000145927 Essential Splice Site 731 1228 9 19

The following transcripts of ENSDARG00000054137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 37468347)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37540860
GRCz11 20 37443739
KASP Assay ID:
554-3572.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTGTCCAGAATCAACTTTATGTTCTTCGGCAGGACGGGGCTCTTTCAG[G/A]TGAACATAANNNTTTYTCTCTCTCTCTCTAMTTACTAWTTTCTTATATTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19240
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076275 Nonsense 769 1227 11 20
ENSDART00000125854 Nonsense 782 1185 15 24
ENSDART00000128321 Nonsense 872 1275 21 31
ENSDART00000145927 Nonsense 770 1228 10 19
ENSDART00000076275 Nonsense 769 1227 11 20
ENSDART00000125854 Nonsense 782 1185 15 24
ENSDART00000128321 Nonsense 872 1275 21 31
ENSDART00000145927 Nonsense 770 1228 10 19

The following transcripts of ENSDARG00000054137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 37472541)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37545054
GRCz11 20 37447933
KASP Assay ID:
2261-4729.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAAAAACCTGCAGGATCCTGTCAGGATAGAGATTGCACATTTGGAGTA[T/A]CAGGTATTCATATTCTGTCAGTAAAGGTACAGATTCTTTATTTAGCTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4922
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076275 Nonsense 769 1227 11 20
ENSDART00000125854 Nonsense 782 1185 15 24
ENSDART00000128321 Nonsense 872 1275 21 31
ENSDART00000145927 Nonsense 770 1228 10 19
ENSDART00000076275 Nonsense 769 1227 11 20
ENSDART00000125854 Nonsense 782 1185 15 24
ENSDART00000128321 Nonsense 872 1275 21 31
ENSDART00000145927 Nonsense 770 1228 10 19

The following transcripts of ENSDARG00000054137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 37472541)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37545054
GRCz11 20 37447933
KASP Assay ID:
2261-4729.1 (used for ordering genotyping assays)
KASP Sequence:
ATCAAAAACCTGCAGGATCCTGTCAGGATAGAGATTGCACATTTGGAGTA[T/A]CAGGTATTCATATTCTGTCAGTAAAGGTAMAGATTCTTTATTTAGCTTGA
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
otic vesicle
ZFA:0000051
protruding
PATO:0001598
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa25142
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076275 Splice Site, Nonsense 1169 1227 20 20
ENSDART00000125854 None None 1185 None 24
ENSDART00000128321 Splice Site None 1275 31 31
ENSDART00000145927 Splice Site, Nonsense 1170 1228 19 19

The following transcripts of ENSDARG00000054137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 37493798)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37566311
GRCz11 20 37469190
KASP Assay ID:
554-7569.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTATCATATTTAGTCCCTCACTCAAGCATTGTGACATATTTGCAGGT[A/T]AAAGTTCCTCCAATCAGAGCAGTCCCAAATGCAGCCCTTCTGACGGAGAG
Associated Phenotype:
Not determined