Busch Lab

ZMP

htr1bd

Ensembl ID:
ENSDARG00000054124
ZFIN ID:
ZDB-GENE-090409-3
Description:
5-hydroxytryptamine (serotonin) receptor 1bd [Source:RefSeq peptide;Acc:NP_001139158]
Human Orthologue:
HTR1D
Human Description:
5-hydroxytryptamine (serotonin) receptor 1D [Source:HGNC Symbol;Acc:5289]
Mouse Orthologue:
Htr1d
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 1D Gene [Source:MGI Symbol;Acc:MGI:96276]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25042 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25042
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042501 Nonsense 153 386 1 1
Genomic Location (Zv9):
Chromosome 17 (position 28227198)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28151125
GRCz11 17 28168088
KASP Assay ID:
554-7369.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGGACGCCTTGGAGTACTCGAAACGGAGAACCATGCGGCGAGCAGCGT[T/A]GATGATTGTCATAGTATGGGTGATCTCCGTCTCTATCTCTTTACCTCCTC
Long Flanking Sequence:
AAATCATGCATAGATGATGTGAAGCGCTGCTGAACCATGCAACATGGATCTGTTCAACAGCTCCGATGAGTTTTTCCTCATCAATGCCACAGTCAGTCCCACAACCCTGGAGTCCTGGGACGACGCCACGCTCCTCAGTCTGCAGATCTCCATCTCTGCCATGCTAGCAATCGTCACTTTGGCCACAGCTCTGTCCAACGCTTTTGTAATCGCCACGATTTTCCTCACACGCAAGCTTCACACCCCTGCCAACTTCCTGATTGGCTCTCTCGCAGCGACAGACCTCCTGGTGTCCATTTTAGTCATGCCGATCAGCATCGTCTACACGGTCAGTAAGACTTGGACTCTGGGTCAGATTGTGTGTGATATCTGGCTATCATCTGATATAACGTTCTGCACGGCCTCCATCCTGCATCTATGCGTGATCGCGCTGGACAGATACTGGGCCATCACGGACGCCTTGGAGTACTCGAAACGGAGAACCATGCGGCGAGCAGCGT[T/A]GATGATTGTCATAGTATGGGTGATCTCCGTCTCTATCTCTTTACCTCCTCTATTCTGGCGGCAGGCGAAGGCTCATGAGGAGCTCACGGAGTGCATGGTCAACACCGACCAGATCTCCTACACGCTCTATTCCACATTTGGCGCCTTTTATGTTCCCACGGTGCTCCTAATGATCCTCTACGGGCGTATCTATGTGGCAGCTCGCTCCAGGATCTTCAAAACACCGGCGACCAGCGGAAAGCGCTTCACTGCTGCTCAGCTCATCCAGAACTCGGCAGGCTCTTCGCTTTGCTCGCTGAACTCCACTTCTAATCAGGAGGGACATCTTCATGCTGGAGGAGGAGGAGGTAGTGGTGGTGGTGGAGGAGGAGGAGGAGGGTCTCCTCTTTTCACGAACAGTGTGAAAGTGAAGCTGGCTGACAGTGTGCTAGAAAGAAAGCGTCTTTGTGCTGCTCGGGAGAAGAAGGCCACCAAGACTCTTGGGATTATCCTGGGTGCGT
Associated Phenotype:
Not determined