Busch Lab

ZMP

zgc:91908

Ensembl ID:
ENSDARG00000054122
ZFIN ID:
ZDB-GENE-040704-17
Description:
transmembrane protein 30B [Source:RefSeq peptide;Acc:NP_001002179]
Human Orthologue:
TMEM30B
Human Description:
transmembrane protein 30B [Source:HGNC Symbol;Acc:27254]
Mouse Orthologue:
Tmem30b
Mouse Description:
transmembrane protein 30B Gene [Source:MGI Symbol;Acc:MGI:2442082]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36434 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076265 None None 341 1 8
ENSDART00000131638 Essential Splice Site None 268 None 7

The following transcripts of ENSDARG00000054122 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28161673)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28085600
GRCz11 17 28102563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATACGAAAGGCGGAAAAGCTGACCCAGGTGTTGAACAAGTAAAACAGG[T/A]ACGGGACTTTGTGAAGGTGTGTCTTTTGTTTTTCGATGTAATTTACGATT
Long Flanking Sequence:
TACCATCAATCAAATGTTGCGGAAAGTAAGGTCTAGTAGGTTATACAAATTCTGCTTGCACGTTTCACCTGTATGCAAAATGTATACTCTGAATCAACAACATAAAATGTAAATTCGGGATCATCAGAGAACCCCAGTAAACATGCTAGGGTGACACAGATTGTCTTAAAATAATTTATAATTAAGTCGCCTACACTAACATAATCTGAAAGATTAACATGCTGAATACTATATCATATTAAACAATTTTTTATAAAAACATGTCTACAAGCTGCAAATTCAGAATTTTATGAAACTAATATTAGCCAGTTAATATCAAGTTTAGATGTCTAAACCATAGACTGTAAAATAAACGATATATGTCTAAACGATATATATCATCTAAAAATAATTAAACCACCAGTCTAATCCGGGAGGGGTCAGCGGTGTGACGTATGTGAAATAGGAGGAGCATACGAAAGGCGGAAAAGCTGACCCAGGTGTTGAACAAGTAAAACAGG[T/A]ACGGGACTTTGTGAAGGTGTGTCTTTTGTTTTTCGATGTAATTTACGATTTTATAAAAGAGGGCATCTAAGAAAAGCCGCACTGCAAACGCCAAACTCTTTTTTGAGGTGAGTTTTGTTTTCTATGGCTTTAAGACTCCTACTCTTAAAACTGTGATCATCAGTGATTGAGGTTTTTGAAGCACGGGTTTGTTTGTTTTCCTGCGATTGTCATCGGTTGTTGTTTTACTGTCGGTTACTCTCAAGGGAATTAACCTTAACTGTAATCAAAATAAGTTATTAGAAGAAGACCGTTAAGAGACATACATTGGTCAATTAATAATAAACACATTACTTTTTAGTCAAATGTAACAAACCAAAACAATTTATACGTAACATTATTTGTGACTCAATCAGCCAATCAAAATTGGTGTTTGCTTATAATAGAAATTGTTTAAACACTTCATTCTGTTCTGTGGAGTTTTAGCAATATAACTGTTGATGTTGCTATACAATTACAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28870
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076265 Nonsense 111 341 4 8
ENSDART00000131638 Nonsense 111 268 4 7

The following transcripts of ENSDARG00000054122 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28165002)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28088929
GRCz11 17 28105892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTTACAGGGTCCTGTCTTCTTTTACTATGGCTTGTCTAATTACTA[C/A]CAGAACTTCAGGAAATATGGCGTGTCATTGGACTACTATCAGCTCTCTGG
Long Flanking Sequence:
AATTTAAAAGGAGATACTGAAAATGACACAGAAAGCAGTTTTTTTAATTCTAGCTGTAAAACTACACAGAACGCTGTGTTTTTGTTAGAATAAGGACTGGTGAAATGATATTCTGATTTTAAACATTTGTCCGCTTCAAACCAACTAAACTTTTGTTTAAAATATTAAATTTCTGGCTTTAACAACCTGTCCTATAATGTTTAAGAATGTGGTCAACAGGTGGTCTTTGGGGGTTGTTTGAACCAACTTGACCCCAGTTTGCTCTCATAATGGAACACTCAAAATCAAATATGTGTTTTCAACTATCTCTGTAAGTGGCTGAAAGTGGACAAACTTTTATAAAGTTTCAGATTTAATTTATACTTGCATTTATCATTGTCCACTTTTGATCAGAATGACAAACACTTATCTTAATACTCAATGTAAATGTTTAAAACTGACTAATGTCTGTGCTGCTTACAGGGTCCTGTCTTCTTTTACTATGGCTTGTCTAATTACTA[C/A]CAGAACTTCAGGAAATATGGCGTGTCATTGGACTACTATCAGCTCTCTGGCGATACACAATATTTCACGGTGTGCATTTGGCAAGAATGATTTTTGAAATGTTTGAAACGTGTTATATCTTGCTTTCCATGTAATGAACTTTGCTTTCCTTGTTCATATTTTCCTCCAGAGTCCACAATCTGTCTGCTCTCCATATAGTTATGACAACCAAAACAGACCCATTGTCCCATGTGGCGCAATAGCAAACAGCATGTTCAACGGTATCATTTCAGTTTTGTAGATCAACTTAATGTGTGCATGTAGCTCTGGGATGTGTCATTAATACTGTAAACCATTTTATTTGGGTAAACTTAATTTAATTCTACCTTCTGCCATAAAGGGACTGTTCACTCTAAAAAGAAAAAATGAACATTTACTCACTATTTACTCATGTACTCAGGTTCCAAACCTTTTTGAGTTTCTTTTGAACACAAAAGAAGATATTTTAAAGCAAGCTGAAA
Associated Phenotype:
Not determined