Busch Lab

ZMP

LOC559281

Ensembl ID:
ENSDARG00000054087
Human Orthologue:
IRS1
Human Description:
insulin receptor substrate 1 [Source:HGNC Symbol;Acc:6125]
Mouse Orthologue:
Irs1
Mouse Description:
insulin receptor substrate 1 Gene [Source:MGI Symbol;Acc:MGI:99454]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35963 Nonsense Mutation detected in F1 DNA Not yet available
sa42600 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35963
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 167 1099 1 2
Genomic Location (Zv9):
Chromosome 15 (position 35196809)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36071000
GRCz11 15 35928969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAACCAAAGGGTCTGGGTCACACAAAGAACTTGATTGGAGTTTACAGAT[T/G]ATGCCTCACCAATAAGACTATCAGCTTTGTGAAACTGAATTCGGATGCAG
Long Flanking Sequence:
CATGGCAAGCCCGACTACGGAGCAAGGATGTTTTTCAGACGTGAAAAAGGTGGGTTATTTAAGGAAACCCAAAAGCATGCACAAAAGGTTTTTTGTACTGAGGGCGGCGAGCGCCTCCGGACCGTCCCGACTGGAGTACTATGAAAACGAGAAGAAGTGGAGACACAAGTCTGGAGCGCCGAAAAGATCCATTCCGCTGGAGAGCTGCTTTAACATCAACAAAAGAGCGGATTCAAAAAACAAACATCTCGTCGCGCTTTATACCAAGGATGAGTACTTTGCTATCGCTGCTGACAGCGAGATCGAGCAAGAGTCATGGTATGAAGCCCTGGTTGATCTCCATAACAGAGGTAAGGTCCACGAAACTGCCCCGGGCCGTGGAGTTGGCGAGGATAATTACGGGGAAGCCACGCCGGGACCTGCCTTTAAAGAGGTTTGGCAAGTTATATTGAAACCAAAGGGTCTGGGTCACACAAAGAACTTGATTGGAGTTTACAGAT[T/G]ATGCCTCACCAATAAGACTATCAGCTTTGTGAAACTGAATTCGGATGCAGCAGCTGTGGTTTTGCAGTTGATGAACATTAGGAGATGTGGTCACTCTGAAAATTTCTTTTTTATTGAAGTCGGCCGATCTGCTGTGACAGGCCCCGGGGAGTTTTGGATGCAAGTGGATGACTCTGTTGTGGCTCAGAACATGCATGAAACTATATTAGAAGCCATGAAAGCCATGAGTGAGGAGTTCAGACCCCGCAGCAAAAGCCAGTCATCTTCTAACTGCTCAAACCCCATCTCAGTGCCTGTCAGGCGGCATCATCACAATAATCCTCCCCCTAGTCAAGTTGGCTTAGGCAGGCGCTCTCGGGCGGAGAGTGTGACGGCCACTTCTCCTGTTAGGCCTGGCAAACACAGCCATTCGTTTAGAGTGAGAGCATCTAGTGATGGAGAGGGCACCATGTCCAGGCCGGCATCTGTGGACGGGAGTCCAAGCAGCCCGAGCAATGCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28509
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 521 1099 1 2
Genomic Location (Zv9):
Chromosome 15 (position 35195748)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36069939
GRCz11 15 35927908
KASP Assay ID:
2260-8837.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTGCTGCATCTTTAGAGGAATACACTGTGATGATGCCTACATACCCA[C/T]GAAGCCGCTCTGCATCATCGTCATCATCAACATATAGGCACTCATTCATG
Long Flanking Sequence:
GATCAATACCCACGCCCACCTCACGGTGCTCCCCCTCAGCCATCAGCCCCATCAGCCTGTCCTCCAGCAGCACGAGCGGGCATGGCTCCACATCTGACTGCCTCTTTCCACGTCGCTCTAGTGCCTCGATATCTGGATCACCCAGCGATGGCGGATTCATCTCCTCAGATGAATATGGATCCAGCCCCTGTGACTTTCGAAGCTCGTTTCGTAGCGTGACTCCAGACTCGCTTGGCCACACACCACCTGCCAGGGAGGAAGAGATAAACAACTACATCTGCATGGCAAAGCCCGGTTCACTTCCTGGTGCCGGGAGCCAGTCACGAAGCCAATCTAGAGGAACACCGTCAAGACTAGAGGAGCCTGAGTTGGAAAAATGTTTTCGGAAAAGAACTCATTCTTCTGGTGCTTCGCCGCCAACTCCATGCCATCAGAAAACTCCCTCACAATCGCCTGCTGCATCTTTAGAGGAATACACTGTGATGATGCCTACATACCCA[C/T]GAAGCCGCTCTGCATCATCGTCATCATCAACATATAGGCACTCATTCATGCCAACACATTCATACCCAGAGGAAGGTACAGATGCATCACAAGCAAAAGATGAAAGGGGGCCAGATCACAAAGATGACGGCTATATGCCCATGCTGCCAGGCGTTGCGCCTGCAACCCCTACAACCAAAAGCAGTGACTACATGCCCATGAGTCCAAAAAGTGTGTCTGCACCACAGCAAATTATCAACCCCAGGCAACACTCGCATGTCGACTCCAATGGTTACATGATGATGTCACCAAGTGGCAGCTGCTCTCCAGATGGCACAACAAACTATGGCAAGATCTGGACGAATGGCATCAACCCTAAGCTCTCCGTAGAGAGTATGGAAGGTAAAGTGTCGTCATGTGGAGATTACATAAACATGTCTCCAGCTAGTTGCTCAACAACAAGTACGCCTCCAGACTGCTTTTTCAACCCTGTGGAAGATCCTCCCAGGCCTATGTATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4621
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 629 1099 1 2
Genomic Location (Zv9):
Chromosome 15 (position 35195422)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36069613
GRCz11 15 35927582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAWGATGTCACCAAGTGGCAGCTGCTCTCCAGATGGCACAACAAACTA[T/A]GGCAAGATCTGGACGAATGGCATCAACCCTAAGCTCTCCGTAGAGAGTAT
Long Flanking Sequence:
AGCCAATCTAGAGGAACACCGTCAAGACTAGAGGAGCCTGAGTTGGAAAAATGTTTTCGGAAAAGAACTCATTCTTCTGGTGCTTCGCCGCCAACTCCATGCCATCAGAAAACTCCCTCACAATCGCCTGCTGCATCTTTAGAGGAATACACTGTGATGATGCCTACATACCCACGAAGCCGCTCTGCATCATCGTCATCATCAACATATAGGCACTCATTCATGCCAACACATTCATACCCAGAGGAAGGTACAGATGCATCACAAGCAAAAGATGAAAGGGGGCCAGATCACAAAGATGACGGCTATATGCCCATGCTGCCAGGCGTTGCGCCTGCAACCCCTACAACCAAAAGCAGTGACTACATGCCCATGAGTCCAAAAAGTGTGTCTGCACCACAGCAAATTATCAACCCCAGGCAACACTCGCATGTCGACTCCAATGGTTACATGATGATGTCACCAAGTGGCAGCTGCTCTCCAGATGGCACAACAAACTA[T/A]GGCAAGATCTGGACGAATGGCATCAACCCTAAGCTCTCCGTAGAGAGTATGGAAGGTAAAGTGTCGTCATGTGGAGATTACATAAACATGTCTCCAGCTAGTTGCTCAACAACAAGTACGCCTCCAGACTGCTTTTTCAACCCTGTGGAAGATCCTCCCAGGCCTATGTATGCTTACTACTCTTTGCCCCGCTCATTCAAACATGCTAACAGGAAGCAGGATCAGAGCCCGCTTCGAGTGTCACTGGGCTCGAGTCGATTAGCATACGCTGACTCCTCTTCATCTTCAGCAAGCAGTGACAGCTTGGGTGGTCAAAGCAATTCCCAGCAGTCTGCTGTCAAACCCAAAAGGTCAGAGGGCAACGGTAGGCTGACACGTCCAACACGGCTGTCACTGGACGCCAGCAAAGCAAGTACTCTTCCACGCACACGTGAGAGCCCCTTCCCTCCTGAGCCTAAAAGTCCTGGGGAGTATGTCAACATTGAGTTCAACGACAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42600
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 708 1099 1 2
Genomic Location (Zv9):
Chromosome 15 (position 35195187)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36069378
GRCz11 15 35927347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCCCGCTCATTCAAACATGCTAACAGGAAGCAGGATCAGAGCCCGCTT[C/T]GAGTGTCACTGGGCTCGAGTCGATTAGCATACGCTGACTCCTCTTCATCT
Long Flanking Sequence:
CATACCCAGAGGAAGGTACAGATGCATCACAAGCAAAAGATGAAAGGGGGCCAGATCACAAAGATGACGGCTATATGCCCATGCTGCCAGGCGTTGCGCCTGCAACCCCTACAACCAAAAGCAGTGACTACATGCCCATGAGTCCAAAAAGTGTGTCTGCACCACAGCAAATTATCAACCCCAGGCAACACTCGCATGTCGACTCCAATGGTTACATGATGATGTCACCAAGTGGCAGCTGCTCTCCAGATGGCACAACAAACTATGGCAAGATCTGGACGAATGGCATCAACCCTAAGCTCTCCGTAGAGAGTATGGAAGGTAAAGTGTCGTCATGTGGAGATTACATAAACATGTCTCCAGCTAGTTGCTCAACAACAAGTACGCCTCCAGACTGCTTTTTCAACCCTGTGGAAGATCCTCCCAGGCCTATGTATGCTTACTACTCTTTGCCCCGCTCATTCAAACATGCTAACAGGAAGCAGGATCAGAGCCCGCTT[C/T]GAGTGTCACTGGGCTCGAGTCGATTAGCATACGCTGACTCCTCTTCATCTTCAGCAAGCAGTGACAGCTTGGGTGGTCAAAGCAATTCCCAGCAGTCTGCTGTCAAACCCAAAAGGTCAGAGGGCAACGGTAGGCTGACACGTCCAACACGGCTGTCACTGGACGCCAGCAAAGCAAGTACTCTTCCACGCACACGTGAGAGCCCCTTCCCTCCTGAGCCTAAAAGTCCTGGGGAGTATGTCAACATTGAGTTCAACGACAAGGCATTTTCAGCGAGCTTAGCATCGCTGTTCCCACCTGTTTATTCAGTAAGTGATGCTGAGGCCCCGTCGGATCTTTCATCATCTGAGTACATGAACATGCAGCTGGGATCCCAGGCCAGACGGCTGTGCTCCGAATTGCAGACTTCCTCTTCCAGTTCAGATTATGCCATAATCACACCGTCAAACTCTGTATCCTCGCCTCCACTGCCATGTGAGAGCATATGTGAACGTGACTAC
Associated Phenotype:
Not determined