Busch Lab

ZMP

fetub

Ensembl ID:
ENSDARG00000053973
ZFIN ID:
ZDB-GENE-050208-4
Human Orthologue:
FETUB
Human Description:
fetuin B [Source:HGNC Symbol;Acc:3658]
Mouse Orthologue:
Fetub
Mouse Description:
fetuin beta Gene [Source:MGI Symbol;Acc:MGI:1890221]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37572 Nonsense Mutation detected in F1 DNA Not yet available
sa24222 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37572
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076082 Nonsense 199 499 5 7
Genomic Location (Zv9):
Chromosome 22 (position 40854387)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37940501
GRCz11 22 37894239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATACAATCTTTTTCTTTTTATTTTGTAGCTTCACTTAGGAAGATTCTA[T/A]ACTGCGGAGTTCACCATCCAGGAAACCGTCTGCTCCTCCAAAACTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24222
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076082 Essential Splice Site 230 499 5 7
Genomic Location (Zv9):
Chromosome 22 (position 40854482)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37940596
GRCz11 22 37894334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGATGTTGATGTCTCGAAATGTGAGCTGATGGCGTGTGAATTTGCGG[T/A]GAGTGTTGAGACTTTTCAGTATAGCAGATGCACAGAAATACAGTCCTCAA
Associated Phenotype:
Not determined