Busch Lab

ZMP

cyp17a2

Ensembl ID:
ENSDARG00000053966
ZFIN ID:
ZDB-GENE-100822-1
Description:
cytochrome P450, family 17, subfamily A, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001099140]
Human Orthologue:
CYP17A1
Human Description:
cytochrome P450, family 17, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2593]
Mouse Orthologue:
Cyp17a1
Mouse Description:
cytochrome P450, family 17, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88586]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30012
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076086 Splice Site, Nonsense 154 495 4 9
Genomic Location (Zv9):
Chromosome 23 (position 45980818)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45830362
GRCz11 23 45565557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGCACACACACTCACACACTCACTCACTGGTATGCTGTGTGTACAGTG[C/T]AGGAGGCGGCTGACAGTCTGTGTGAGGAGCTCCAGGCCTGCAGGGGTCAG
Long Flanking Sequence:
TAGAATTTTGTAACATTTCTGGAACTTTGTAAAATTTCTAGATCTTTGAAACAATTCTAGATTTTTGTAACATTGTAACAATTCTAGATCTTTGTAACATTTCATGAATTTTGTAACAATTTTAGAACTTATCTAAAACTTTGTAACAATTCCAGATCTTTATAAAAATTCTAGATCTTTGTAACATTTCTATTACAAACATTTCTAGAACTTTGTAACAATTCTGGAATTTTGTAACATTTAAGAACTTTAACAATTCTAGATCTTTGTATAATTTAAGAACTTTGTAACATTTCTAGATCTCTGAAATATTTAAGAAATTATTAACAATTCTAGAACTTAACTAGAGCTTAGCAAAATTTGGAATATTGTATTATTTTTAGGACAGTGAAAGATTTTTAGAACTGACTTACGCTTATAAACACGCAAATACACTCAGACACATACACACACGCACACACACTCACACACTCACTCACTGGTATGCTGTGTGTACAGTG[C/T]AGGAGGCGGCTGACAGTCTGTGTGAGGAGCTCCAGGCCTGCAGGGGTCAGAGTTCAGATCTGAGTGTGGTGTTGATGCGCGCCGTCACTAACGTGATCTGCAGGCTGGTGTTCAGCTCCTCCTATCAGCCCAGCGACCCCGAGCTGCAGACCGTCATACAGTACAACGACGGCATCGTGCAGACCATCGCCAGAGGGGGACTCGTGGACATCTTCCCCTGGTTAAGAGTCAGTAGCTCCGCTCAGATCACCGCTGCTCATTATCAGCTGATAGATTTAGAAAATAGATTTATACACAGACGTGGACAAAATTGTTGGCGTCTTAATTCTTTCCAGGTCGGCTTCAGTAGTTTGTCTTTTTTAACGCTTCTGTTGAACCACAGTTCGAAAGCAATGTCTGATTTACATTGCCTTATCTTCAGTAATTATTCATTAATCAGTCTCTTCAGTTTCTTGCTATTTTAGTAACCACTGTAGTTTCTCCTTCTTCAACAGAAGAGT
Associated Phenotype:
Not determined