Busch Lab

ZMP

tgfa

Ensembl ID:
ENSDARG00000053939
ZFIN ID:
ZDB-GENE-040724-208
Description:
transforming growth factor, alpha [Source:RefSeq peptide;Acc:NP_001137524]
Human Orthologue:
TGFA
Human Description:
transforming growth factor, alpha [Source:HGNC Symbol;Acc:11765]
Mouse Orthologue:
Tgfa
Mouse Description:
transforming growth factor alpha Gene [Source:MGI Symbol;Acc:MGI:98724]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26799
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Missense, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076061 Missense, Splice Site 134 191 4 5
Genomic Location (Zv9):
Chromosome 6 (position 40932740)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41004340
GRCz11 6 41001876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGTGGCATCAAACCACCGGCAGCAGACCGTGGCCACCATGCTGGTGT[T/A]GTGTGTGGTGGGCAGTGTCATGCTCATGCTGATCTGCACTTTACTTAAGT
Long Flanking Sequence:
AGCAGTTCATAGTAAAACGTCAAATGAATGAAAATCAGTTTAAGTGTGATTGGTTTCATAAAGATGATTCACATGGCTTTATGAAAAAGATTCCTCATTTTGTGACTAAACACTTTACTAAATGCATTCTTTTTCTTGCATACTGGGGTTTAATTCAATTCAACTCATCTTTATTTCTATAGCGCTTTTACAATGAAGATTGGGTCAAAGCAGCTTAACATATAAGTTTTGATAAATTCAAACTGTGTCAGTCCAGTTTTCAGGGTTAAAGTTCAGTTCAGTGTGGTTTAATTTTCACTGCTGAAAGTCCAAACACTGAAGAGCAAATCAGTATTATTCATCTCCCTTTTGAGTAGTAATGAAACGCATTCTGATGTAATTTATTATTATTTTTTGTAGATGCCATCCTGGCTTTGTGGGCATGCGGTGTGAACATGCAGATCTCCTAGCAGTGGTGGCATCAAACCACCGGCAGCAGACCGTGGCCACCATGCTGGTGT[T/A]GTGTGTGGTGGGCAGTGTCATGCTCATGCTGATCTGCACTTTACTTAAGTAAGTATTATTTATTTAGAACACATTTCAATTGTACTTTACTATTTAAAGTGACATCGGCAAATCTAAAAATCTATGAAATGGATAAAAACAATATTCAGAGGTATTTCATTAAAATCATGTAAAATAGGTAAAGGTCATGTAAAATGCTAAATCATTTATACTCTCTAAAGTGTAAGTTCAGTTGAATAATTCAATAATTGATGAGGAATCCCATTAAAATGATCTAATAATTCATCTGAAGTACGATGTTAATCTGGAGTATGTAATGTAAAATATACTTTTTGATCCACAAATATAAACAATTTTGTGTCCAAAATGTTTTTATTAACAACTTGACAGAAAAAAACAAACAAACATCGTACAAGATTTTATTCGATTTTAGCTGATTTGATTTTTTTTTTATTGACAAATAGATAACGCCCGATTCAGACAGGGCTTCAGCGTCAACC
Associated Phenotype:
Not determined