Busch Lab

ZMP

ankrd55

Ensembl ID:
ENSDARG00000053869
ZFIN ID:
ZDB-GENE-080104-7
Human Orthologue:
ANKRD55
Human Description:
ankyrin repeat domain 55 [Source:HGNC Symbol;Acc:25681]
Mouse Orthologue:
Ankrd55
Mouse Description:
ankyrin repeat domain 55 Gene [Source:MGI Symbol;Acc:MGI:1924568]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa18027 Essential Splice Site Available for shipment Available now
sa16616 Essential Splice Site Available for shipment Available now
sa16758 Essential Splice Site Available for shipment Available now
sa34844 Essential Splice Site Available for shipment Available now
sa17099 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18027
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
Genomic Location (Zv9):
Chromosome 10 (position 7837346)
KASP Assay ID:
554-7921.1 (used for ordering genotyping assays)
KASP Sequence:
CTGATCTRTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACRCACACACACACACACACAC
Long Flanking Sequence:
CAACAAAAAAGCAAACCTCTTTTATCCATTCACGCATGCGAGTTAAACTGCAATTACAATTCAATTGCCTTTCTTTTATTCATTTAATCTTTTCATTTAGGCTTCCACATTCAGAAGCTCTGTATATTGCTTTGTGTAAATAAGACCATATATAATCTTCCGAGCAGGCTGACAAGTGCTGCTTCTGCACATGCTCAGTGTGATTCCCGTCACACATCACGCCAAATCAAACGGTGCTGCTCCTCCACCTGCCGCCTCCAGGAACTGATGCTAGCGGATCTGCGACACCTCCAACCCCGCTCTCAGCCGCTCGTTCCACACTGTTATCCCTTTCTCCGTCTCTCTTTTACCGTGTCTGTCCATTTCCTCCGGGTTTCCCCTCCGTATTGGGGTGGCTGTGAGCGGTCAGTCATGTCGTGGGCACCAGAGGGATTTCTCTGAAGACGGCATCTGATCTGTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACTGATAACAACAAGGGGTTAGTGCCGCTGCCACTGTTGCCATGGTAATGTTATCAACGGGCTTTGCCAATGCCCATCATTTGCTATCTTGATGTGAGGGTTGCCATCTGTTTGTCTGTGGGTAAATCACCAGAAGATGGGAAGGGCTGTAGGTGTAATAGGGGATGATGAGGTGTGTTGTAGGTCTGTCAGCATGTTCTCTGTGTTGTTGTGTGCGCAAAACATCCTACAAGCACCCTAGACAATATATAGAAACCCAAAGGAACGTCTGATTTCTCAGTGGTTGCCAAACCTGTAATGATTTCTCAGTATGGTTCATTTCATCAGTGCTGATTCCACTGTACGTCTCCTTAGAAATTAATTATTTGAAGGAGTCGTTGACAACAGGGGTTTATAAAAGATCAGATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
Genomic Location (Zv9):
Chromosome 10 (position 7837346)
KASP Assay ID:
554-7921.1 (used for ordering genotyping assays)
KASP Sequence:
CTGATCTRTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACRCACACACACACACACACAC
Long Flanking Sequence:
CAACAAAAAAGCAAACCTCTTTTATCCATTCACGCATGCGAGTTAAACTGCAATTACAATTCAATTGCCTTTCTTTTATTCATTTAATCTTTTCATTTAGGCTTCCACATTCAGAAGCTCTGTATATTGCTTTGTGTAAATAAGACCATATATAATCTTCCGAGCAGGCTGACAAGTGCTGCTTCTGCACATGCTCAGTGTGATTCCCGTCACACATCACGCCAAATCAAACGGTGCTGCTCCTCCACCTGCCGCCTCCAGGAACTGATGCTAGCGGATCTGCGACACCTCCAACCCCGCTCTCAGCCGCTCGTTCCACACTGTTATCCCTTTCTCCGTCTCTCTTTTACCGTGTCTGTCCATTTCCTCCGGGTTTCCCCTCCGTATTGGGGTGGCTGTGAGCGGTCAGTCATGTCGTGGGCACCAGAGGGATTTCTCTGAAGACGGCATCTGATCTGTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACTGATAACAACAAGGGGTTAGTGCCGCTGCCACTGTTGCCATGGTAATGTTATCAACGGGCTTTGCCAATGCCCATCATTTGCTATCTTGATGTGAGGGTTGCCATCTGTTTGTCTGTGGGTAAATCACCAGAAGATGGGAAGGGCTGTAGGTGTAATAGGGGATGATGAGGTGTGTTGTAGGTCTGTCAGCATGTTCTCTGTGTTGTTGTGTGCGCAAAACATCCTACAAGCACCCTAGACAATATATAGAAACCCAAAGGAACGTCTGATTTCTCAGTGGTTGCCAAACCTGTAATGATTTCTCAGTATGGTTCATTTCATCAGTGCTGATTCCACTGTACGTCTCCTTAGAAATTAATTATTTGAAGGAGTCGTTGACAACAGGGGTTTATAAAAGATCAGATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16758
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
Genomic Location (Zv9):
Chromosome 10 (position 7837346)
KASP Assay ID:
554-7921.1 (used for ordering genotyping assays)
KASP Sequence:
CTGATCTRTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACRCACACACACACACACACAC
Long Flanking Sequence:
CAACAAAAAAGCAAACCTCTTTTATCCATTCACGCATGCGAGTTAAACTGCAATTACAATTCAATTGCCTTTCTTTTATTCATTTAATCTTTTCATTTAGGCTTCCACATTCAGAAGCTCTGTATATTGCTTTGTGTAAATAAGACCATATATAATCTTCCGAGCAGGCTGACAAGTGCTGCTTCTGCACATGCTCAGTGTGATTCCCGTCACACATCACGCCAAATCAAACGGTGCTGCTCCTCCACCTGCCGCCTCCAGGAACTGATGCTAGCGGATCTGCGACACCTCCAACCCCGCTCTCAGCCGCTCGTTCCACACTGTTATCCCTTTCTCCGTCTCTCTTTTACCGTGTCTGTCCATTTCCTCCGGGTTTCCCCTCCGTATTGGGGTGGCTGTGAGCGGTCAGTCATGTCGTGGGCACCAGAGGGATTTCTCTGAAGACGGCATCTGATCTGTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACTGATAACAACAAGGGGTTAGTGCCGCTGCCACTGTTGCCATGGTAATGTTATCAACGGGCTTTGCCAATGCCCATCATTTGCTATCTTGATGTGAGGGTTGCCATCTGTTTGTCTGTGGGTAAATCACCAGAAGATGGGAAGGGCTGTAGGTGTAATAGGGGATGATGAGGTGTGTTGTAGGTCTGTCAGCATGTTCTCTGTGTTGTTGTGTGCGCAAAACATCCTACAAGCACCCTAGACAATATATAGAAACCCAAAGGAACGTCTGATTTCTCAGTGGTTGCCAAACCTGTAATGATTTCTCAGTATGGTTCATTTCATCAGTGCTGATTCCACTGTACGTCTCCTTAGAAATTAATTATTTGAAGGAGTCGTTGACAACAGGGGTTTATAAAAGATCAGATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34844
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 564 650 10 11
Genomic Location (Zv9):
Chromosome 10 (position 7816371)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5825421
GRCz11 10 5826640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACGCGCAACAGTCTTGCTCCCATCCGTGACCACTGCACTCACAGATG[T/C]AAGTTTACATCACTGTAACATAATTTCATGCCTCATAAGTCTAGTTGTAA
Long Flanking Sequence:
TGCAGCTGGTAGGGCATCCGCTGCGTAAAACATGTGCTGAATAAGTTGGCGGTTCACTCCGCTTTGGCGACCCCAGAATAATAAAGGGACTAAGCCGAAAAGAAAATGAATGAATAAATTATACATTTTACAAACATAGCGTTTCATGTTTCTTTGTTACAATTAAGTGATCTTTTATTTGAGTAATATTTTACTGTATCTGCAAGTATGTTTTTAAACGTCGATCTGTAAACACATAGAACTCAATTTTAGTTTTTCTCTTAGATTTCAAAAGTACTCAAGCATGCCGTTTCTATTTCCTAATTGAAGAAACATCCAGTTATAAAAGAGTATATCAGCCTTTAAATTCTTACTTGAACTTTGGAAATTGATTCTTGCATTTTTTTGTGTGTGTTTCTTCTCCAAGCAGCTCAAAATCATCTTTTACCTCTGAGAGTTCGAGAATCTGCTCTCACGCGCAACAGTCTTGCTCCCATCCGTGACCACTGCACTCACAGATG[T/C]AAGTTTACATCACTGTAACATAATTTCATGCCTCATAAGTCTAGTTGTAATTCATGATGAAGTAAAGGCTGCAAGAGTTTCTTCGCGTTGTCATTTATGTGACAACAAATTTTGACAAACAAAATTTGACATTTCTGGTTGATTTTGTAATGTTTACACCTTATATTTAAACAATAAGACTGCAGTTGACTGAAATGTCAACTTAAGGTTCTTAAATAACTTTTTTTATGTAAATGTGGAAAGATGAGTGGCGTGAAACAGATCATATGAAAACTAGATCAAACTAAAAACAGGGAAAACAGCATCATAAAGTCCATAACCATGACAAATAACTTTTTTTTTTTCAGAATCACGAGATGTTCAGTTTATAGATAGATGCACTGTAAAACCAAACTGTGAAATTAAATTCAGTTGAATGAGTTCATTTCACTCAAATATTAAAAAAGTCATTATTGTTAGCAAATAAGTAATGATTATGTTGTGAGAAATACTGTTTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17099
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Nonsense 621 650 11 11
Genomic Location (Zv9):
Chromosome 10 (position 7814376)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5823426
GRCz11 10 5824645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGCCCGTCGCTYGGCTCCTTCCCGACTCCAYKCACAGGAGAAYCTTTA[C/T]GAAACATTCAAGTTCTTCCTGCCATTCCTCCTCAGAGAAAACGCAGCCCT
Long Flanking Sequence:
CTAGCTGAAATAAAACAAATAAGACTTTCTTCACAAGAAAAAAATATTATCAGACATACTGTGAAAATTTCCTTTCTCTGTTTAACATAATTTGGGAAATATTTAAAGTTAAATAAATTTAAAGGGGGGCTAATAATTCTGAATATATAAAACGTATATACAGTATAAACAATATAAGTATATAAGTGATATAAACCTACAATTCTAAAATAAATTCTCAAAATTAGGATTTTATTTGTTGCAGTTGTGAGTTTCCACATAAATTAAAATAGGTATTTACAGTAAATATGTTTTTGAACCATGCTATTTTTGCTTTAATGTCGTCCACAGTTTCCTTACCACCTGACCAGGTGTCCCAGGGAGTGAGGAAGTCCAAATCCTCTGTAGGAGTGGGTTTGGCTGTACTTCCACCTCCTTTTGCATCTAAACTGCACCGAGTCGGAGTTCCTCAAAGCCCGTCGCTCGGCTCCTTCCCGACTCCACTCACAGGAGAACCTTTA[C/T]GAAACATTCAAGTTCTTCCTGCCATTCCTCCTCAGAGAAAACGCAGCCCTTCTCCCCTCACAACCCTGAGCCACTCCAAAATCACAGACTGATGGAGATTCCTGTTTCAACACTGTTCAGACTTTTCATTTCGATTCGTTTAAACGATGACGCATCACTGTTTGATAAACCTGCAGAGTCTCAAACACAGGCTATTTTTTCATACAATTTTACAGATTTGATCTTTTTCTATGGTTATGCACATGGTCGAACTGTAACATTTGAACATGCGGATTGTTTACTGTTACTGTTAATAAAGGATATTGTTTAAAAATCAAGCAGTAATAACTTATTATTGTCTTTGAAATATGATCGCGGGGTATTCATTTTAGACATTTTAGGTTTAATAAATGGTTTATTATGTAAGAGGGAATTTACAGTACAGCACTATTTTATTCACAATAGCCAGAGGTTATACCAACCCAGGCTCATTCTGAAAACGTACTGCTATGTACATTTCT
Associated Phenotype:
Not determined