Busch Lab

ZMP

plekhh1

Ensembl ID:
ENSDARG00000053835
ZFIN ID:
ZDB-GENE-061219-1
Description:
Pleckstrin homology domain-containing family H member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q00IB7]
Human Orthologue:
PLEKHH1
Human Description:
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Plekhh1
Mouse Description:
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 Gene [Source:MGI Symbol

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa39172 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa11978 Essential Splice Site Available for shipment Available now
sa28898 Nonsense Mutation detected in F1 DNA Not yet available
sa9622 Essential Splice Site Available for shipment Available now
sa23139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39172
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Splice Site, Nonsense 69 1432 3 30
Genomic Location (Zv9):
Chromosome 17 (position 38133493)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38018390
GRCz11 17 37965975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAACAGAGAGTCATAGAGGCTGACCAGAGAGCAGAGAGCGCCGAAAAG[C/T]AGGTATTGCTATTGAAAACAATGTTGTCTCTTTCAGAATTCATCTGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11978
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Essential Splice Site 760 1432 15 30
Genomic Location (Zv9):
Chromosome 17 (position 38153646)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38038543
GRCz11 17 37986128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCATGGATAAAGAAGTCAAGCCTACAGCGCKAGGCTGGTTAAYAAAGG[T/C]AAGAGTTCACWKGAGTGTTAACAATGYRCTCCATTATTTCGTTTCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28898
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Nonsense 782 1432 16 30
Genomic Location (Zv9):
Chromosome 17 (position 38159138)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38044035
GRCz11 17 37991620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAAAGCTTGTGTGGTGTGCCTTAATTGGGAAAGTCTTTTACTACTAC[C/T]GAAACCAAGAAGACAAGGTGAATATCTTCACATTTCTGAATTAAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9622
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Essential Splice Site 787 1432 16 30
Genomic Location (Zv9):
Chromosome 17 (position 38159156)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38044053
GRCz11 17 37991638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCCTTAATTGGGAAAGTCKTTTACTACTACCGAAACCAAGAAGACAAG[G/A]TGAATATCTTYACWTTTCTGAATTAAAAGCTTTTCAAAGTTTTMATTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4014
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Nonsense 1145 1432 24 30
Genomic Location (Zv9):
Chromosome 17 (position 38178897)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38063794
GRCz11 17 38011379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATCTCCAAATGGGAACAGGCACTGAAGGAGCTTCATCCTGGAAAATA[T/A]GAAGGAACACGAACGGTCCGGCTCACCTATAAAAGCAGGTGTGTTACACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28899
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Essential Splice Site 1295 1432 27 30
Genomic Location (Zv9):
Chromosome 17 (position 38181134)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38066031
GRCz11 17 38013616
KASP Assay ID:
2261-1376.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTGGCCCGCAAGTGGCCTCTGTTCGGGGCCAAGCTCTTCAATGCCAAG[G/A]TAAGATCAGATCAGTAGATCGTTTCTGCTTTCACAAACTAGAGATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23139
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Nonsense 1370 1432 29 30
Genomic Location (Zv9):
Chromosome 17 (position 38187095)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38071992
GRCz11 17 38019577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGGCTTTGGGCAAAAAGACTGTGGATAAACTTCTATTTGCAATGGCT[A/T]AACCAAAGGTAAGACGTGATGTTACAAAAGGTAAAACAGAGTTTAACAGC
Associated Phenotype:
Not determined