Busch Lab

ZMP

si:ch211-218m3.19

Ensembl ID:
ENSDARG00000053817
ZFIN ID:
ZDB-GENE-091116-93

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37370 Nonsense Mutation detected in F1 DNA Not yet available
sa43712 Nonsense Mutation detected in F1 DNA Not yet available
sa24022 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37370
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099864 Nonsense 25 315 1 2
ENSDART00000132774 Nonsense 25 314 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39144133)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40284198
GRCz11 21 40307751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCATTCTTCTAGTGGAGGGATTCAGAGTTACACCTCAGTCCACCTA[T/A]CCTGTCTTCATTCTTCTTCTCCTGGCTTATGTTTTTACAATGGTCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43712
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099864 Nonsense 44 315 1 2
ENSDART00000132774 Nonsense 44 314 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39144188)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40284253
GRCz11 21 40307806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCATTCTTCTTCTCCTGGCTTATGTTTTTACAATGGTCTCCAACATC[G/T]GACTTATAGTTCTAATATCGACTGAGAAGAATCTTCATCATCCTATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24022
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099864 Nonsense 151 315 1 2
ENSDART00000132774 Nonsense 151 314 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39144511)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40284576
GRCz11 21 40308129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGCTATAATGACCAATAAGATGGTTATTAAGCTCTCAGCATCAGCCTG[G/A]GGGTTGGCTATTCTTCTTGTGACAATTATGTTAGGCCTGACTATACGCCT
Associated Phenotype:
Not determined