Busch Lab

ZMP

si:busm1-160c18.1

Ensembl ID:
ENSDARG00000053739
ZFIN IDs:
ZDB-GENE-030616-170, ZDB-GENE-041124-5
Description:
LOC795595 protein [Source:UniProtKB/TrEMBL;Acc:A4FVL7]
Human Orthologues:
HLA-DMA, HLA-DMB, HLA-DOA, HLA-DPA1, HLA-DQA1, HLA-DQA2, HLA-DRA, XXbac-BPG181M17.5
Human Descriptions:
Major histocompatibility complex, class II, DM beta [Source:UniProtKB/TrEMBL;Acc:A2AAT6]
major histocompatibility complex, class II, DM alpha [Source:HGNC Symbol;Acc:4934]
major histocompatibility complex, class II, DM beta [Source:HGNC Symbol;Acc:4935]
major histocompatibility complex, class II, DO alpha [Source:HGNC Symbol;Acc:4936]
major histocompatibility complex, class II, DP alpha 1 [Source:HGNC Symbol;Acc:4938]
major histocompatibility complex, class II, DQ alpha 1 [Source:HGNC Symbol;Acc:4942]
major histocompatibility complex, class II, DQ alpha 2 [Source:HGNC Symbol;Acc:4943]
major histocompatibility complex, class II, DR alpha [Source:HGNC Symbol;Acc:4947]
Mouse Orthologues:
H2-Aa, H2-DMa, H2-DMb1, H2-DMb2, H2-Oa
Mouse Descriptions:
histocompatibility 2, O region alpha locus Gene [Source:MGI Symbol;Acc:MGI:95924]
histocompatibility 2, class II antigen A, alpha Gene [Source:MGI Symbol;Acc:MGI:95895]
histocompatibility 2, class II, locus DMa Gene [Source:MGI Symbol;Acc:MGI:95921]
histocompatibility 2, class II, locus Mb1 Gene [Source:MGI Symbol;Acc:MGI:95922]
histocompatibility 2, class II, locus Mb2 Gene [Source:MGI Symbol;Acc:MGI:95923]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38702 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41258 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075834 Essential Splice Site 102 242 2 4
Genomic Location (Zv9):
Chromosome 8 (position 36136373)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 35204877
GRCz11 8 36136421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATATAGTCTCTTTGACTAAAATTTTTAACAGCCCACCACCAGAAATGGG[T/A]AAGCCCCATAAATTAATTGCAAAATACTAACAGCTGCAGTTAGCAGGAAT
Long Flanking Sequence:
ATTATTAATAACACTCAATTAATCACTTAATGATATCATTAAATTAATCACTACGTCTGTGTTAAGGTTCAAACCAGATGAAAACTCAACATTGAATTTTTTTTAATTTTCAGAGTTGAACTATGTAGAAGAACACCACATCATTCCTATTTCATGTATAAATAAGCTAATACTGTAATTAAACTAAAACTTAATAAACTAAACTTTTCTAATGCCAATTCTCTTTCAGTTGTACATGATTATTTTTCAATTCATGGATGCTCTTATACAGACGAAGAGGGTATGCAAGCAGTTGATGGAGAGGATATGCATGGAATTGATAATGAGGAGATGTGGCATGCTGACTATAATCTGAAGACAGGAGTACTATCATTACCTGACTTTGGAGACCCTATTACATTTCCTAGATTTTATGAAACAAGTGTTATTGAAATGACAGGATGCAAAGCTAATATAGTCTCTTTGACTAAAATTTTTAACAGCCCACCACCAGAAATGGG[T/A]AAGCCCCATAAATTAATTGCAAAATACTAACAGCTGCAGTTAGCAGGAATATGTATCTGTTATTTTACAGTTCTCTACCATAAATGGCATAATACAGTTTGTTAAACTGAAGTTACACAGCATTAAAGAGAGTAACTGCAATTGCAATTGCAAATTAATTTTTGCTCTTGAAGTTAAATTGATGTTTTCTGTCTTTTTTTTGTATTATTCAATAACTTTATTCAAAAAATATATTTATTTTTGTGGTCTATGAAGTAAAAATGTACTAATATGCTTACATTGCTAAAGCATTATGAATAATATTAATATCAATAATAATATTCATTTGAGTTTTCTGGAAATTAAAAGTTTACTTGTCACCTACTCGGTCCCAGTCATTCCCCTCGCTGGCCAGCAGAGGTCATCATCACCGGACTTCTAACATTACGTCATCCACTTACACTGACAGCATGCACACCTGCAGCTCATTCAATTAATTACCCACGCTTACACATATAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41258
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075834 Nonsense 109 242 3 4
Genomic Location (Zv9):
Chromosome 8 (position 36132467)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 35200971
GRCz11 8 36132515
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTAATGCAGTTATTTGTGTTTCTAGATCCACCACAGACATCTATATA[T/A]CCAAAAGATGATGTTGAGCTGGGTGTTCAGAACACTCTTGTCTGCCATGC
Long Flanking Sequence:
AGCTCTGCAGATTTTATCAAACATGCTTAACAATATCTAGTAGTCTTGAACACCTTGATTATTTGGATTAACTGCGTTTTGATTAGGGTTGGAGCAAAACTCTGCAGAGCTGAAGAGCTTCAGGAATTGAGTTTGAGACCCATGCTTTAGTGGTTCAATTAGAATATTATCAACAATTAGAATACTTTTGTGTACATAAAACAGAAATTACTTTACTTAACAGTTTCTTCTCCTCAGTGTTAGTGTAAATTGTGCGTTCATTTGTCATGTTTAGATTGCGTGTCTGCATAACCTAAGATGTGCTTTATTTTTTTTTATAATAAAGTATTCTCACTGAAGGTCACTCCACTTTGAGTTTTTTTTTTTTTTTGTGTGTGTGGGAACAGAAATTAAATTGTTATATATCCAGTGCCAAGTTTTGTTAAGTTATGGTGATGTCAATATTTGTTTAAACTAATGCAGTTATTTGTGTTTCTAGATCCACCACAGACATCTATATA[T/A]CCAAAAGATGATGTTGAGCTGGGTGTTCAGAACACTCTTGTCTGCCATGCGACTGGATTCTATCCTCCGTCTATTAGAATCTTGTGGACTATGAATAATGTCAATGTGACAGAAGGCATTAGTTTAAGCCAGTATCGTCCAAGGGTAGATGGGACCTTCAACATCTTCTCCACATTTAGGTTCACACCAGCTGAGGGAGACATTTACAGCTGCAGAGTGATCCATGAAGCACTTCTTGGTCAACCTCAGGCCAAAATATATGGTGAGTATGAGGATGTTGTATCTTTTTAGTTCAACTCTTATTATGTTAAAAACAATATTTTCATCTGTTGTAATTTTCTTGCATCCTCAAACAGAATATTTAGAATATTAAAAATAGAATTAATGTATTTTACCAGATGTTGATGTTGCCATCCCAAGTGTTGGACCATCAGTGTTCTGTGGAGTGGCTCTGTCTCTTGGACTTTTGGGTATCGTGACTGGAACTTTCTTTTTTATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30543
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075834 Essential Splice Site 197 242 3 4
Genomic Location (Zv9):
Chromosome 8 (position 36132203)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 35200707
GRCz11 8 36132251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTGATCCATGAAGCACTTCTTGGTCAACCTCAGGCCAAAATATATGG[T/A]GAGTATGAGGATGTTGTATCTTTTTAGTTCAACTCTTATTATGTTAAAAA
Long Flanking Sequence:
TCATGTTTAGATTGCGTGTCTGCATAACCTAAGATGTGCTTTATTTTTTTTTATAATAAAGTATTCTCACTGAAGGTCACTCCACTTTGAGTTTTTTTTTTTTTTTGTGTGTGTGGGAACAGAAATTAAATTGTTATATATCCAGTGCCAAGTTTTGTTAAGTTATGGTGATGTCAATATTTGTTTAAACTAATGCAGTTATTTGTGTTTCTAGATCCACCACAGACATCTATATATCCAAAAGATGATGTTGAGCTGGGTGTTCAGAACACTCTTGTCTGCCATGCGACTGGATTCTATCCTCCGTCTATTAGAATCTTGTGGACTATGAATAATGTCAATGTGACAGAAGGCATTAGTTTAAGCCAGTATCGTCCAAGGGTAGATGGGACCTTCAACATCTTCTCCACATTTAGGTTCACACCAGCTGAGGGAGACATTTACAGCTGCAGAGTGATCCATGAAGCACTTCTTGGTCAACCTCAGGCCAAAATATATGG[T/A]GAGTATGAGGATGTTGTATCTTTTTAGTTCAACTCTTATTATGTTAAAAACAATATTTTCATCTGTTGTAATTTTCTTGCATCCTCAAACAGAATATTTAGAATATTAAAAATAGAATTAATGTATTTTACCAGATGTTGATGTTGCCATCCCAAGTGTTGGACCATCAGTGTTCTGTGGAGTGGCTCTGTCTCTTGGACTTTTGGGTATCGTGACTGGAACTTTCTTTTTTATTAAAGCATTCAACTACAATGTAGATATGGAAGTAAATTGACAAACTGATCATTTTAAGTAACTGTGTATTTTAAAACTGGGTTCAATGTTGTTGTTTTGTTTGTTTGTTTTTTTGTTTTGTTTTTTACATTTGATGATATTCAATTATCAATTTGCTAGTGTTTTGCTGTTTGCATGTGTCACAGCTTAAGTCACAGCTCATTTGAGCTCTCTCTGCAACACTGTAAATAAAAAAACTTTTAAAAACACTTAGATTCTACAGGAAA
Associated Phenotype:
Not determined