Busch Lab

ZMP

Q6DG47_DANRE

Ensembl ID:
ENSDARG00000053713
Description:
LOC553231 protein [Source:UniProtKB/TrEMBL;Acc:Q6DG47]
Human Orthologue:
CCDC88C
Human Description:
coiled-coil domain containing 88C [Source:HGNC Symbol;Acc:19967]
Mouse Orthologue:
Ccdc88c
Mouse Description:
coiled-coil domain containing 88C Gene [Source:MGI Symbol;Acc:MGI:1915589]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa2919 Splice Site, Nonsense F2 line generated Not yet available
sa45617 Nonsense Mutation detected in F1 DNA Not yet available
sa5633 Nonsense F2 line generated Not yet available
sa23144 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4724
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Essential Splice Site 162 1997 7 30
Genomic Location (Zv9):
Chromosome 17 (position 38822313)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38707210
GRCz11 17 38654795
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACATCACATATGAGGCATGTATTTATGGCCTACAATTCCTCTTGATTGC[A/T]GGTAACGCACAATCAGGAGAATGTTCTGGACCTGCAGTGGATGGAGGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4725
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Nonsense 464 1997 13 30
Genomic Location (Zv9):
Chromosome 17 (position 38826984)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38711881
GRCz11 17 38659466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACAGCCCGTAAGTCATTTGTGTTTGAGYTGAACGAGTCMGCATCCAGC[C/T]GACTGTTGAAGCTTGAGAARGAAAACCAGTGCCTTCAGAGCACCATYCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2919
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Splice Site, Nonsense 555 1997 14 30
Genomic Location (Zv9):
Chromosome 17 (position 38827346)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38712243
GRCz11 17 38659828
KASP Assay ID:
554-3145.1 (used for ordering genotyping assays)
KASP Sequence:
AACAGAGAATGGAGAAAACTTTGGAGACAATYCAGGCAGAGAAAGAYAGA[C/T]AGGTGAACATCWAAAGAAAGAMAAGTAAACCCATGATGATWAGGGKTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45617
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Nonsense 629 1997 15 30
Genomic Location (Zv9):
Chromosome 17 (position 38829554)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38714451
GRCz11 17 38662036
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAACGTCAAGTGACTAAAGAGCTGGAATCTCTCCGCGAAAGAGGAGAG[C/T]GATGCGAGGAGTTGGAAAGGGAAGTTCCTCGTCTAGAGAGAGTCCGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5633
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Nonsense 1429 1997 25 30
ENSDART00000062010 Nonsense 1429 1997 25 30
Genomic Location (Zv9):
Chromosome 17 (position 38856355)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38741252
GRCz11 17 38688837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTCATYAAACCCAAGAAAGAAAGTTCACGAGAGAGACCAGACGCTCCA[C/T]GAGAAAGRATTMGAAGTGCTCCAGACATYCCTCTTCCGGAGATCCCCWCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2936
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Nonsense 1429 1997 25 30
ENSDART00000062010 Nonsense 1429 1997 25 30
Genomic Location (Zv9):
Chromosome 17 (position 38856355)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38741252
GRCz11 17 38688837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTCATYAAACCCAAGAAAGAAAGTTCACGAGAGAGACCAGACGCTCCA[C/T]GAGAAAGRATTMGAAGTGCTCCAGACATYCCTCTTCCGGAGATCCCCWCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Essential Splice Site 1615 1997 29 30
Genomic Location (Zv9):
Chromosome 17 (position 38875403)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38760300
GRCz11 17 38707885
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCATCTCACACTGTACAGCTCATGGTTTATTCTCCTGTTTTCCTCCA[G/A]GGTCTCTGGATTGTCTGCAGGGCCGATCTGCCAGTCTGTCCAGTGATGAT
Associated Phenotype:
Not determined