Busch Lab

ZMP

LOC100334697

Ensembl ID:
ENSDARG00000053709
Human Orthologues:
ACHE, BCHE
Human Descriptions:
acetylcholinesterase [Source:HGNC Symbol;Acc:108]
butyrylcholinesterase [Source:HGNC Symbol;Acc:983]
Mouse Orthologues:
Ache, Bche
Mouse Descriptions:
acetylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:87876]
butyrylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:894278]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40201 Nonsense Mutation detected in F1 DNA Not yet available
sa44580 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40201
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075788 Nonsense 23 576 1 8
Genomic Location (Zv9):
Chromosome 4 (position 2128687)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2418394
GRCz11 4 2267707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTGAGTTTGTGTGTGTTTTTCCTCACTGACTCCAGATCAGATGCT[C/T]AGATCAATGTATCTGCTGTACTGCGCAGTGTTTCTCCATCAGCACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44580
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075788 Essential Splice Site 189 576 2 8
Genomic Location (Zv9):
Chromosome 4 (position 2130958)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2420665
GRCz11 4 2269978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCAGCAACTACACACAGACGGTGATCGTGAGCATCGCATATCGCCTGG[G/A]TGAGTCACAAACTGACCATAATAATCATAACCAGGGGTTTGATTTATTAA
Associated Phenotype:
Not determined