Busch Lab

ZMP

gb:bc097249

Ensembl ID:
ENSDARG00000053652
ZFIN ID:
ZDB-GENE-100112-1
Description:
LOC569692 protein [Source:UniProtKB/TrEMBL;Acc:Q4V8Q6]
Human Orthologue:
C8orf38
Human Description:
chromosome 8 open reading frame 38 [Source:HGNC Symbol;Acc:28625]
Mouse Orthologue:
2310030N02Rik
Mouse Description:
RIKEN cDNA 2310030N02 gene Gene [Source:MGI Symbol;Acc:MGI:1924197]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17886 Essential Splice Site Available for shipment Available now
sa28721 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17886
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075718 Essential Splice Site 76 343 1 9
Genomic Location (Zv9):
Chromosome 16 (position 43174911)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40558361
GRCz11 16 40508393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAACTCGACACGACAGCACAATGAACAGTACTGTATTGACAKAGTAAGG[T/A]AAGTTTTGAGTTAAAAGGTTCATTTGCTTKATATAGTTTTACATGGAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28723
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075718 Essential Splice Site 150 343 3 9
Genomic Location (Zv9):
Chromosome 16 (position 43172869)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40556319
GRCz11 16 40506351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACAGAGATGACCCTCCAGCACAGCCTGTCAGTGCAGAACTGTGGAGGG[T/G]GAGTCTTCACTCTTCTTTATAAAAGAAAAGGGCTTTTCACAATTTATATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28722
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075718 Essential Splice Site 151 343 4 9
Genomic Location (Zv9):
Chromosome 16 (position 43170845)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40554295
GRCz11 16 40504327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTGTAAGAAATTATTATTTTTATTACATTTAACTGCTTTGTGTTCAC[A/G]GGCGGTAAGGAAACACACACTGACAAGGAGGTGGATGTTGAGAATTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28721
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075718 Nonsense 324 343 9 9
Genomic Location (Zv9):
Chromosome 16 (position 43154385)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40537835
GRCz11 16 40487867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGCAGAGAGTGAGGAAAGTCGATTTCGACGTGTTTCACCCCAGCCTA[C/T]AGAAGAGGAATCCAACACTGCCCCTTCAGCTGTATTTACGGTCATGGAGA
Associated Phenotype:
Not determined