Busch Lab

ZMP

anxa2b

Ensembl ID:
ENSDARG00000053625
ZFIN ID:
ZDB-GENE-030131-1089
Description:
annexin A2b [Source:RefSeq peptide;Acc:NP_001099070]
Human Orthologue:
ANXA2
Human Description:
annexin A2 [Source:HGNC Symbol;Acc:537]
Mouse Orthologue:
Anxa2
Mouse Description:
annexin A2 Gene [Source:MGI Symbol;Acc:MGI:88246]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20962 Nonsense Available for shipment Available now
sa30887 Nonsense Mutation detected in F1 DNA Not yet available
sa40910 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20962
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 67 338 3 12
ENSDART00000124028 Nonsense 67 338 4 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30868230)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29260572
GRCz11 7 29531722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGACGAGCAGACAATCATTGACATTCTGACAAGACGCAGTTACTTACAA[A/T]GAAACGATATTGCATTTGAGTATGAAAAGCGAGCAAAGAAGGTACAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30866521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29258863
GRCz11 7 29530013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGTGTTCATTCATCTACTTGTTTTTCCCAGTGTTTAAGAAGGACT[T/A]GGAGAAAGATATTTCTGGAGACACATCTGGAGATTTTGCGAAGCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40910
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13
ENSDART00000057289 Nonsense 154 338 6 12
ENSDART00000124028 Nonsense 154 338 7 13

The following transcripts of ENSDARG00000053625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30866521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29258863
GRCz11 7 29530013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGTGTTCATTCATCTACTTGTTTTTCCCAGTGTTTAAGAAGGACT[T/A]GGAGAAAGATATTTCTGGAGACACATCTGGAGATTTTGCGAAGCTGCTAC
Associated Phenotype:
Not determined