Busch Lab

ZMP

prdm1b

Ensembl ID:
ENSDARG00000053592
ZFIN ID:
ZDB-GENE-080618-2
Description:
PR domain containing 1b [Source:UniProtKB/TrEMBL;Acc:A5XCE7]
Human Orthologue:
PRDM1
Human Description:
PR domain containing 1, with ZNF domain [Source:HGNC Symbol;Acc:9346]
Mouse Orthologue:
Prdm1
Mouse Description:
PR domain containing 1, with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:99655]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23609 Nonsense Available for shipment Available now
sa43356 Nonsense Mutation detected in F1 DNA Not yet available
sa12402 Nonsense Available for shipment Available now
sa18430 Nonsense Available for shipment Available now
sa7302 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23609
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 24 377 2 3
Genomic Location (Zv9):
Chromosome 19 (position 50152156)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48516996
GRCz11 19 48177786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCAGTTGCAGCACTTCATTGACGGTTATGATGTCCGGCTCAGCAACTG[G/A]ATGCGTTACGTTAACCCGGCGCGCTCGCTGGCCGAACAGAACCTGGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43356
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 107 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50144591)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48524561
GRCz11 19 48185351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATATGGAGTACCAGAAGCCTCCTCTACCTCAGTACACATATTACCCC[A/T]AACACCCCTCGAACCCACAAAACCATCCCTGCGACACAAATAAAGACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12402
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 199 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50144313)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48524839
GRCz11 19 48185629
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTCACCGAGAGGGTTTGATCTCCTCATATCCGTCAATACGGTCTCCATA[T/A]CCGCTCTTACCGCAGTATAACCCTCATTACCARCACATGCTCATTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 346 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50143872)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48525280
GRCz11 19 48186070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATCCACTGAARAAGCAGAACGGGAAGATCAAMTATGAATGCAATGTCTG[T/A]ATGAAGACTTTCGGACAGCTCTCCAATCTTAAAGTGAGTACAATGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7302
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130671 Nonsense 372 377 3 3
Genomic Location (Zv9):
Chromosome 19 (position 50143795)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48525357
GRCz11 19 48186147
KASP Assay ID:
554-4758.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTAAAGTGAGTACAATGTGTGTGTTTAAATGTGTTATATCACCTATTT[T/A]AAAAGTGAAGNNNATATACTAAAGGTTAACTCTGTATTTATCTTGCTGAAGGY
Associated Phenotype:
Not determined