Busch Lab

ZMP

fancd2

Ensembl ID:
ENSDARG00000053574
ZFIN ID:
ZDB-GENE-040116-5
Description:
hypothetical protein LOC402960 [Source:RefSeq peptide;Acc:NP_991224]
Human Orthologue:
FANCD2
Human Description:
Fanconi anemia, complementation group D2 [Source:HGNC Symbol;Acc:3585]
Mouse Orthologue:
Fancd2
Mouse Description:
Fanconi anemia, complementation group D2 Gene [Source:MGI Symbol;Acc:MGI:2448480]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa20790 Essential Splice Site Available for shipment Available now
sa20789 Essential Splice Site Available for shipment Available now
sa20788 Nonsense Available for shipment Available now
sa9077 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7045 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18469 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20790
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 552 1445 18 45
ENSDART00000125089 Essential Splice Site 552 1659 17 45
ENSDART00000128777 Essential Splice Site 552 1445 18 44
Genomic Location (Zv9):
Chromosome 6 (position 42256088)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42327142
GRCz11 6 42324678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCAGTCGCCTGGCATTCGGACAGGAGCAGCATGGAGGACACATCCAG[G/A]TAAGAAACGCTTCTTTTGAAATACATAGTATACAATGTCTTTTAAATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 864 1445 27 45
ENSDART00000125089 Essential Splice Site 864 1659 26 45
ENSDART00000128777 Essential Splice Site 864 1445 27 44
Genomic Location (Zv9):
Chromosome 6 (position 42248560)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42319614
GRCz11 6 42317150
KASP Assay ID:
2259-7987.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATGATACCATCTTCTTCAGTCGTTCAACAAAAGAAAGGAAAGAAAGG[T/C]AAGGTTGCTGGGGAAATGACCAAACTTGAATTCTGTTGGTGTTTAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Nonsense 893 1445 28 45
ENSDART00000125089 Nonsense 893 1659 27 45
ENSDART00000128777 Nonsense 893 1445 28 44
Genomic Location (Zv9):
Chromosome 6 (position 42247941)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42318995
GRCz11 6 42316531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACTCCTCTGGTGACAAGTCACAGCTAGAGGGAGCAGCAGATGCAGAA[G/T]AGTCCCAACCGGTAAAAACCCCATATATTGTCTCTACTTTTATTTACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 991 1445 30 45
ENSDART00000125089 Essential Splice Site 991 1659 29 45
ENSDART00000128777 Essential Splice Site 991 1445 30 44
Genomic Location (Zv9):
Chromosome 6 (position 42246696)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42317750
GRCz11 6 42315286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGACTTCAGTTTAACTTCCGCTCCAGCCAAAAAGGCTCCATTTCTCAAA[G/A]TATGAACACAAACACTGCGTAAATAATTGRCCTACTGTAAAYKAATTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5381
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Nonsense 1133 1445 34 45
ENSDART00000125089 Nonsense 1133 1659 33 45
ENSDART00000128777 Nonsense 1133 1445 34 44
Genomic Location (Zv9):
Chromosome 6 (position 42234369)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42305423
GRCz11 6 42302959
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGCAGAACTTCCGAAGCACYGTRCCCAGTCTGAACACAGCCCTGTGCT[T/A]GACACAGCTGCTCATTGTGTTGTCTCAGTATGGGGGATCAAACCACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7045
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 1189 1445 36 45
ENSDART00000125089 Essential Splice Site 1189 1659 35 45
ENSDART00000128777 Essential Splice Site 1189 1445 36 44
Genomic Location (Zv9):
Chromosome 6 (position 42231220)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42302274
GRCz11 6 42299810
KASP Assay ID:
554-5079.1 (used for ordering genotyping assays)
KASP Sequence:
TCCAAAATATYTCTGAGGATGTTTTTCTGTAATGTTGTTTTTCTGCTGTA[G/A]TATTTATCTGGAGCACACAGATGATGTTCTGAAGGCRGTGGAGGAAATAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3612
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Essential Splice Site 1323 1445 40 45
ENSDART00000125089 Essential Splice Site 1323 1659 39 45
ENSDART00000128777 Essential Splice Site 1323 1445 40 44
Genomic Location (Zv9):
Chromosome 6 (position 42230392)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42301446
GRCz11 6 42298982
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCAAGCTTGGAATGCCTCTGCTTGACTACAGCTTTAAAAAACACAAGG[T/C]ATTTGTGTTACGTTCATTTTACAGGGTATCTGCGGGCTCTGAAATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18469
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064969 None None 321 None 4
ENSDART00000075601 Nonsense 1407 1445 43 45
ENSDART00000125089 Nonsense 1407 1659 42 45
ENSDART00000128777 Nonsense 1407 1445 43 44
Genomic Location (Zv9):
Chromosome 6 (position 42224274)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42295328
GRCz11 6 42292864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGTTTGTTTTGTTTTTGCAGGGTGAAGAGATTCTCTCTCAGAGGTCA[C/T]AGGCAGCTGATGAAGAGGAGGAAGAGTCCTCTCAGCTACAGAGCGAAGCA
Associated Phenotype:
Not determined