Busch Lab

ZMP

ms4a17a.11

Ensembl ID:
ENSDARG00000053561
ZFIN ID:
ZDB-GENE-050417-157
Description:
membrane-spanning 4-domains, subfamily A, member 17A.11 [Source:RefSeq peptide;Acc:NP_001017670]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5272
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021194 Nonsense 120 252 4 7
ENSDART00000021194 Nonsense 120 252 4 7

The following transcripts of ENSDARG00000053561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 60624524)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75005649
GRCz11 4 76582387
KASP Assay ID:
2259-5223.1 (used for ordering genotyping assays)
KASP Sequence:
TCGCTCTCCATTGCTGCTRACAGCAAWATTAATTCACCAGCCGGTTTRTG[T/A]TTGGTAWGTACACAACACTTGCTCTTTTCATGGGTCTACWCACTGGGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18793
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021194 Nonsense 120 252 4 7
ENSDART00000021194 Nonsense 120 252 4 7

The following transcripts of ENSDARG00000053561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 60624524)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75005649
GRCz11 4 76582387
KASP Assay ID:
2259-5223.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCTCTCCATTGCTGCTGACAGCAAAATTAATTCACCAGCCGGTTTATG[T/A]TTGGTATGTACACAACACTTGCTCTTTTCATGGGTCTACACACTGGGCAC
Associated Phenotype:
Not determined