Busch Lab

ZMP

rtkn2

Ensembl ID:
ENSDARG00000053558
ZFIN ID:
ZDB-GENE-041010-225
Description:
Rhotekin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q5XIZ9]
Human Orthologue:
RTKN2
Human Description:
rhotekin 2 [Source:HGNC Symbol;Acc:19364]
Mouse Orthologue:
Rtkn2
Mouse Description:
rhotekin 2 Gene [Source:MGI Symbol;Acc:MGI:2158417]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42988 Nonsense Mutation detected in F1 DNA Not yet available
sa32171 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42988
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075596 Nonsense 63 641 2 13
ENSDART00000136431 Nonsense 63 641 2 12
Genomic Location (Zv9):
Chromosome 17 (position 43664471)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43629146
GRCz11 17 43619684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATATTAAGGAGAAGATGGAGTTTGAGATGCGAATGAGAGCGGGGGCTTA[T/G]AAGCTTATGGTTGCGAGCACTAAAAAGGAGCAGGTCTTGGATGCATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32171
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075596 Essential Splice Site 125 641 4 13
ENSDART00000136431 Essential Splice Site 125 641 4 12
Genomic Location (Zv9):
Chromosome 17 (position 43663794)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43628469
GRCz11 17 43619007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATAATTTCAGTTTCTTTGGTTCATAATTTTTTTCCTTTTGGCTTATCC[A/T]GGTCTACGTATTCCACTGTTTTGGAAGGATTCAGAGCACTTTAACAGCAA
Associated Phenotype:
Not determined