Busch Lab

ZMP

wu:fc07b10

Ensembl ID:
ENSDARG00000053544
ZFIN ID:
ZDB-GENE-030131-2412
Human Orthologue:
HSPA4L
Human Description:
heat shock 70kDa protein 4-like [Source:HGNC Symbol;Acc:17041]
Mouse Orthologue:
Hspa4l
Mouse Description:
heat shock protein 4 like Gene [Source:MGI Symbol;Acc:MGI:107422]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36496 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36495 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28912
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075574 Nonsense 49 833 2 20
Genomic Location (Zv9):
Chromosome 17 (position 43508295)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43472970
GRCz11 17 43463508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCGACAGAGCGTGTATTTCACTGGCCTCTAAAAACAGGACCATT[G/T]GAAATGCTGCTAAAAGTCAGGTATGAAGTGATATGTATGATTCATACTTT
Long Flanking Sequence:
ATGATGACAGAATTTTTATTTTTGGTGAACAATCTCTTTAACTGGCACTTTTAAATGCACTTAAATTTACATTGATTGCACTGTTATAATGGATAAATTATTAAAGTAAAGTATAAAAAACACAGAATCAGATGATTGCTTAGGGATTTTGACAGTGCCAGTCATAAATCTAGCCACTCTAAAATGCAGAAGTCATCCTGCTCCCTCCTGTGAGAAGTTACTTTGAAAACCTCCACCTGCTGGCAGTCTCGATATGCCTTAACATACCTTTTCAAATCTCAGAAGCTCATTTCACACCGCAACACAGTTTTTGACTCAGGAAAAGGCTCTTGTGGAGACGCTGTCCAAGGTGCTGATCCGCACCCTGCTCCTCCATATACTCTATAATGCATCAGTTTGGAAATAAAATATGGAGGCTGTTTCTTCACAATGTATGATACATTTATGTCATCTCTCTCGACAGAGCGTGTATTTCACTGGCCTCTAAAAACAGGACCATT[G/T]GAAATGCTGCTAAAAGTCAGGTATGAAGTGATATGTATGATTCATACTTTGTGAATTCTGAAGTATGTTAATGATCAAAGTACTTCTGAAACCTGTGCTCTGCAGATTATTACTAACTTTAAGAACACAGTTCACGGCTTTAAGAAGTTTCACGGTCGAGCGTTCGATGACCCGTTTGTTCAAGGAGAAAAGTCCAGGTTGCCTTATAGCCTTCACAAACTGGACAATGGCAACGCTGGAATAAAGGTAATTTATTTTTAATTGTGTATGGTCTTTATTTTATATTTTTGACCAACATTTTTAGTTTAAAAAAAGTGCATTGTCAAATCTTGCATTTGTTTTTTCTAGAAATCAATGACCTCTTTAAACTCTTGTTATTTGCAACACTGGTGTGCCTTGAGTGCTCTTACGGGATTATCATAAACATTTGTGTTTTCACACAAAAGGGTTTATGGAGCATGTGTTAATGTAATTTTCTTTTTATTTACCTGGCAAAAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa833
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075574 Essential Splice Site 525 833 12 20
Genomic Location (Zv9):
Chromosome 17 (position 43489943)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43454618
GRCz11 17 43445156
KASP Assay ID:
554-0736.1 (used for ordering genotyping assays)
KASP Sequence:
GATGGACACAGAGCCTACTGTACAGAATGAAGGCAGGCCAGAGGAGCAGG[T/C]AGGAAACTTTTTAGGTTCAATTAATTAATACCTAATTAATAAAATTAGTT
Long Flanking Sequence:
TTGCTGTTGTTCTGAATGGCTTCCACATTGTTATAATACCGTTTTAAAGTTTTAATAGTCAGGAAATTTTAAAAAATGACCTTATTGCATAGATGACAACTTATTAAATTGTCACAAATTCACTGAGCTCCTGAGAGAAACCTGTTCTTTCGCAGATATTTGTAGAAGCAGTCTGCATGCCTAATGCTTGATTTTATACACATGTTGTCATGGAAGTGACTGGAAATTCTTAATGCAAAGATTTGGAAGGGAAAATTATAATGGCAATATAAAGTATTATTTTCTGCTTTTGTTGTGTCCAGGCCGCTTTAGTGTACAGAATGTTGTGCCGCAGCCTGATGGGGACAGTTCAAAGGTCAAGGTGAAAGTGCGTGTGAATGTGCATGGCATTTTCAGTGTGTCCAGTGCATCTCTGATAGAGAAGCAGAAAGGAGAGCCGGAGGACGTGCAGATGGACACAGAGCCTACTGTACAGAATGAAGGCAGGCCAGAGGAGCAGG[T/C]AGGAAACTTTTTAGGTTCAATTAATTAATACCTAATTAATAAAATTAGTTTGCATGTTGTTGCCGTATTTGCGTTGCCTCCGGGTGCTCCCGTTTTACCCACAAGTCCAAAGACATGCTCTGTAGGTGAATTGGGTAAGCTTGTCTGTAATGTATGTGTGTGAATGAGAGTGTATCCCAGTGATGGGTTGCAGCTGGAAGGGCATCCGCTGCTTAAAACATATGCTTGATAAGTTGGCGGTTCATTCCGCTGTGGCGACCCCAGATTAAGGGACTAAGCCAAAAATGAATGAATAAATCAATCAATCAAATTCAAGTCTTGTGGGATTCTGTAAACGACAAGACTAGAGAGAAATATATTAATAATTAGATAAACCAAAAACAAAGAGATAATTTATTACTCTTCATGCTGATTTAAGTCAGTGTGAATTTCTCTTTTCCTGAAACACAACAGTTTTCATTTTCGCTGGTGTGACTAATTTAAACTCGCTGCTGTTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36496
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075574 Essential Splice Site 603 833 15 20
Genomic Location (Zv9):
Chromosome 17 (position 43484457)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43449132
GRCz11 17 43439670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCCGTCAGCTGGATCGAGATGTGCTCACCCATTTTGTTGAATATGAAG[T/C]GAGTCTAGTGCTTTTTCCATTTACATTTAGCCTGCCTCATTTCCCCTGGA
Long Flanking Sequence:
CATCCATTCATCTACCCACCTATCCTGCCATTCATCCATCCATCCATCCACTCTTCCATCCACCCGCTCATCCATCCATCCACCCAACCACCCACTCAACCACTCATCCATCTATCCACTCACCCATCCATCCATCCAATCACTCACCCATCCTGCCAGCCACTCATCCATCTATCCACTCACCCATCCATCCACTCATCCATCCAGCCACTCATTTATTCATCCACTCACCCGCCCACTTATCCATCCATCTAAACAGCCACTCATCCATCCACCCACTCATCCATCCATCCAATTTTTTTAAATGACATCTTAAAAGAACACAGCTTTCTTGATAATTGTATATTTTGACATTTTGTTAAAGGACGGTGATAAGCAGGATCAAGGTGCAAGCAGTAGCAAAGCCAAGTCAAAGGTGAAGAGTGTAGATCTGCCCATTCTGGCCAACACCACCCGTCAGCTGGATCGAGATGTGCTCACCCATTTTGTTGAATATGAAG[T/C]GAGTCTAGTGCTTTTTCCATTTACATTTAGCCTGCCTCATTTCCCCTGGAGAACATGCTGAGTGTTGCTATTAATTCAACTCAGCTCAGTAAAAATCTGTTCTCTTTACAGAAATCCAGACTGCCTTTTTTGATCCCCATCTCAAGTCTTAGCTAAATTTTTTGCACTTTCAGAGATAATATATACAAAGTCATTATACTTGTCTCTTGGTAGCTCCTGTTTATGACACATGCCAGCACAACTGATTGTATCTTGTACTCTGCGTGTTGCTAAAATCTACAAGGGATTTAGCGATTGCCCTAAATATCCATGACAGAGCTCAATTCAGACCTTAGGGAAAAGATATTAGTAGATCATTGCGTCAGTGAAGCGCAAGCACAGCGCTTAGCATTAGAGTCATGCCACACACTCACTGTTTCATCCTTTGCCATTAAAAATGAAAATACCATGTAATCTCACACTATAGGGCTCTAAATATAAGTCTGAACTTTGGCCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36495
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075574 Nonsense 631 833 16 20
Genomic Location (Zv9):
Chromosome 17 (position 43482357)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43447032
GRCz11 17 43437570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGGAATGATGCCAAAAATGGCGTGGAGGAGTACGTTTACGACCTG[C/T]GAGACAAGCTGTGTGGCATCTACGAGAAATATGTCACTGAAGATGTGAGC
Long Flanking Sequence:
AAAAAAATGCTAGTGTATCGCTGCAAGTGAATAGTCAGTATAAAAGTATAAAAGTATAGTTCATCCAAATATGATTGAACCCTGAAGATATTTTGAAGAATGTTGGAAATAAATAGCCTTGTTTTTTTACTATGATTGTCAATGCTACTGGTTTCTAGTATTGTACAAAATGTTTTTTTTAGTTTTCAGCAGAAATGAAACTTAAAATGGTTTGGAACCACTTAAGCATAAAGAAAAGATAATTTTTGTGTGAACTATCCAATCAAGCACATGTCTTTTCACAAGAGAATCTTTGCTGTCTCATTTATAATCTGGTTAATTACAGTGTTTAATTTTTGTTTGTCCAAATAGGGTGATAGAAGTAAATGTCAGTAGTGAATGTATTCAAAGCCCAGCTAGTAAAGCATTGTCTCTTCCAGAAAAAAATGATCATACAGGACAAGCTGGAGAAGGAGAGGAATGATGCCAAAAATGGCGTGGAGGAGTACGTTTACGACCTG[C/T]GAGACAAGCTGTGTGGCATCTACGAGAAATATGTCACTGAAGATGTGAGCACATCATTTCGTTGTTATCCAGAGTTGATGTTCTCAGACAAGCTTATGTTTTATTCCCTTTATAATCTACCTGAATTCCTGCAATTCAGAAAATACTTACATATGTGTGTTGATATGGGAGGGTTAATATGTCTCTATTGCAGGAAAGTAATCGGCTCACCATAATGCTGGAGGACACAGAAAACTGGCTGTATGAAGAAGGAGAGGACCAGGACAAAGAAATCTACCAGCACAAGCTGGCTGAACTCAAAGTATGTGCTTAGACGTCATATGGTTATTGAATTAAAAAAATTAAATGAAAACTTAGGTAACACTTTAGTTTAGGTCACAATTCATGCTATTAACCACCTGCCTGTTAATAAGATATTAACTGCTCATTAATAGTTAGAAATTAAAAAAGTAAAAAGTCATTAAAAAGTAGGATCTTATTCTGCAACCCTAATCCTACTC
Associated Phenotype:
Not determined