Busch Lab

ZMP

cog3

Ensembl ID:
ENSDARG00000053504
ZFIN ID:
ZDB-GENE-050913-26
Description:
conserved oligomeric Golgi complex subunit 3 [Source:RefSeq peptide;Acc:NP_001137512]
Human Orthologue:
COG3
Human Description:
component of oligomeric golgi complex 3 [Source:HGNC Symbol;Acc:18619]
Mouse Orthologue:
Cog3
Mouse Description:
component of oligomeric golgi complex 3 Gene [Source:MGI Symbol;Acc:MGI:2450151]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21613
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036994 None None 773 None 23
ENSDART00000122511 None None 194 None 7
ENSDART00000122909 None None 293 None 10
ENSDART00000126948 Nonsense 231 824 6 24
ENSDART00000131605 None None 763 None 22
Genomic Location (Zv9):
Chromosome 9 (position 55926670)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54343260
GRCz11 9 53882855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGAAGGATTCGTCCCCATGCTCTCCAAATTAGACGAATGCATAGAATA[T/G]GTTTCATCACATGTAAGTAATCCTGCAGTATTCTCATCGGATGATCTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27503
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036994 Nonsense 712 773 21 23
ENSDART00000122511 None None 194 None 7
ENSDART00000122909 Nonsense 232 293 8 10
ENSDART00000126948 Nonsense 763 824 22 24
ENSDART00000131605 Nonsense 702 763 20 22
Genomic Location (Zv9):
Chromosome 9 (position 55869415)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54305935
GRCz11 9 53845530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGATGTCCACATATCGAGTCCTGAAGAACAAGCTTCCCAGTACATTA[C/T]AGAGCATGACTTTATATCTGGCCAATAAAGACACAGAGTTCATCCTGTTC
Associated Phenotype:
Not determined