Busch Lab

ZMP

cbsa

Ensembl ID:
ENSDARG00000053500
ZFIN ID:
ZDB-GENE-050417-367
Description:
cystathionine-beta-synthase a [Source:RefSeq peptide;Acc:NP_001104702]
Human Orthologue:
CBS
Human Description:
cystathionine-beta-synthase [Source:HGNC Symbol;Acc:1550]
Mouse Orthologue:
Cbs
Mouse Description:
cystathionine beta-synthase Gene [Source:MGI Symbol;Acc:MGI:88285]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10945 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10945
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053932 Nonsense 244 571 6 15
ENSDART00000126746 None None 84 5 6

The following transcripts of ENSDARG00000053500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28010679)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28276237
GRCz11 1 29080069
KASP Assay ID:
2259-0660.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCATATTCTGGACCAATATCGCAATCCCAGCAACCCCCTGGCTCATTA[T/A]GACACCACTGCAGAGGAAATTCTGGAGCAATGTGATGGTAGTTGTTTTANNT
Long Flanking Sequence:
TTATTAAAACTATTATGTTTATACATATACATATACTGATACTTTTGTCATCTACATTTCACCATTCCAAGTATGAATCATTTTGAATGTTATGTTAATCATAGTGCCCTTTTGTAGTGTTTTTTTTTTCCTTATATATGCGCAAAATATTCAGGTCTTAAGGAGTTTGGTTGTGTTCACTTTGTGCAGGTATTGGTCTTGCACTGGCTGCAGCGGTAAAGGGTTATCGCTGTATAATTGTTATGCCTGAGAAAATGAGCATGGAAAAGGTAAAATTAATTCCAGTTGTAGCAAAACCTGATTTGATGAAGTGATACAAGAGTCTTTTCATAGGTTGATGTGTTGAGAGCTTTGGGAGCAGAGATTGTCCGAACACCCACCAGTGCTCGGTTTGACTCCCCAGAGTCACATGTGGGAGTGGCTTGGCGCTTGAAAAATGAGATCCCTAACTCTCATATTCTGGACCAATATCGCAATCCCAGCAACCCCCTGGCTCATTA[T/A]GACACCACTGCAGAGGAAATTCTGGAGCAATGTGATGGTAGTTGTTTTATTTTTTCATTGTTTCTCTCTGACTTTGTTCTTGTCTTTTTTTGCTTTTGAACTTAGCAGCACAAATGGAGTTCACTCTTGCTGTGTTTGTCCTGTTGTCTTAAATAATTTACTCACCTTTGTCCAGGGAAAGTGGATATGCTGGTGGCAGGAGCTGGCACAGGTGGCACCATTACTGGCATCGCTCGGAAATTGAAGGAAAAGTGCCCAAATATTAAGGTATACATAGCTCGTTTTGTTTGTGTGTGTGTGTATATATATATATGTGTTAATTTTATAAGAGCATGCTGCAATTTTGTAATCTTACCACTTATAAGTTTGTGATTGGGCCCAAGTAATGTGAATGGGCCTGATGTGGCAGGGTAAATCTCAACAATGAAGTCTGTCTGTGTTTTGCTAGATTGTCGCTGTGGACCCAGAGGGCTCAATCCTTGCTGAGCCTGATGAACTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25593
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053932 Essential Splice Site 393 571 10 15
ENSDART00000126746 None None 84 None 6

The following transcripts of ENSDARG00000053500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28015196)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28280754
GRCz11 1 29084586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGACAGCGGTGTGTTGTGATTTTGCCAGACTCAATTCGCAACTACATG[T/A]AAGTATATTAATATTAATAATTCCTTACATTTATTTAGTGCTTTTCTGGA
Long Flanking Sequence:
TGCCAGGTTTCTGTGAGACAGAGTGCATTAAGATTGTTATCTTTTATTTCATTTATGATAAGTGCTTTAGGTGCTAGTGACCTAATGTCTAGGAGACCAAGCTTTACAAAATTTGTATTTTCACTTTTTAGTTTCTGGTTTGATTCTTAATAGATCGAAGTCTCTATGGGGGTAGCCAGACATGTATTACTGTGATTTAAGTGGGACGAACAAGAGTTTAGTTTACGAGGCATAGTTCAAGAAATGTTTTTAAGCAAACCAGAAAACCTAACTTATGCATTTACATATATGTTAACAAATTGTGGCTTAATATGTATGATAAGTAATATCATTATTGTAGTTTGTACCTGTAAGTATACACTGCATTGTTTGCATTTTTGTCTCTTCTGTCAGGTGGTAGTTCAGGCACTGCCATGGCAGCTGCAGTAAAATTTGCCAAAGAGCTGAAGGAAGGACAGCGGTGTGTTGTGATTTTGCCAGACTCAATTCGCAACTACATG[T/A]AAGTATATTAATATTAATAATTCCTTACATTTATTTAGTGCTTTTCTGGATTCTCAAAACACTTTACACATTTTTGGTGAGAATCTCAATTTACCACCAGTGTGCAGTATCCACCTGGGTGACGCGATGGCACCCATATTGTGTGCCATCGCAGACCTAACAGTAGCTGATAGGTGGAGAGGAGAAAGTGTGATGAAGCCAACAATGATATAGGGATGCTGGGAGGCCATGAGATAGAGACCAGTGGGCGAATTTTGCCAGGATGCCGGGGTTAAAACCCTTCTGTTTTTCGAAGGACATCCTGGGATTTTTAACAACCACAGTGTGTCAGGACTTCGGTTTACCGTCTCTTCAGCAAAGACGGCAGCGTTCACTGAGCAGTATAGAGTCCCTACACAGACCACAGGTTGAGCGCTCCCTGCTGGTCTCACTAACACCACTTCCAGCAGCAACCTAGCTTTCTCATGTGGTCTCCCATCCAGGAACTACTGAATTGCAGA
Associated Phenotype:
Not determined