Busch Lab

ZMP

aldh1a2

Ensembl ID:
ENSDARG00000053493
ZFIN ID:
ZDB-GENE-011010-3
Description:
retinal dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_571925]
Human Orthologue:
ALDH1A2
Human Description:
aldehyde dehydrogenase 1 family, member A2 [Source:HGNC Symbol;Acc:15472]
Mouse Orthologue:
Aldh1a2
Mouse Description:
aldehyde dehydrogenase family 1, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:107928]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16776 Essential Splice Site Available for shipment Available now
sa2367 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa16776
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075519 Essential Splice Site 300 518 8 13

The following transcripts of ENSDARG00000053493 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31670000)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30062342
GRCz11 7 30333492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGGAGCTCGGGGGAAAGAGTCCCAACATCATTTTTGCAGATGCTGATT[G/A]TAAGTAWTCWGACACTGTTTTACGGCTGGCCTCCTGTTGTCCCGCTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2367
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075519 Essential Splice Site 470 518 11 13

The following transcripts of ENSDARG00000053493 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31666864)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30059206
GRCz11 7 30330356
KASP Assay ID:
554-2940.1 (used for ordering genotyping assays)
KASP Sequence:
ATCAGCAAGGCCATGACCATCTCTGCAGCAGTGCAGGCYGGCACCGTCTG[G/A]TAAGACAAAAACTTACACAAAAGTCACAAAAAAKATRGATAGCCAAATCA
Associated Phenotype:
Not determined