Busch Lab

ZMP

lipc

Ensembl ID:
ENSDARG00000053476
ZFIN ID:
ZDB-GENE-040426-1361
Description:
hepatic triacylglycerol lipase [Source:RefSeq peptide;Acc:NP_957316]
Human Orthologue:
LIPC
Human Description:
lipase, hepatic [Source:HGNC Symbol;Acc:6619]
Mouse Orthologue:
Lipc
Mouse Description:
lipase, hepatic Gene [Source:MGI Symbol;Acc:MGI:96216]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12401 Nonsense Available for shipment Available now
sa20975 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12401
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075508 Nonsense 24 514 1 9
ENSDART00000129385 Nonsense 24 514 2 10

The following transcripts of ENSDARG00000053476 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31729341)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30121683
GRCz11 7 30392833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTCTYGTGCTTTCTGATGATCTCACAGCTCACTGATGGAGCAAYGTTT[C/T]AGGGAAATCGAGCAGGTGAGGGTCAATTACACTTGTCTTAAAGGGMTAGT
Long Flanking Sequence:
TTAATGCAAGTACTGAAGCCAATCACTTGGGCACAAGCTTTGTAAATATTTCAAGACCATGTGATGATGACTACAGTATAAGAGTGGAGAAAAAGTGGATTTAAATGACTTGTGGCATGGTCCGAGTATTTCCATTAATACCAAATCTGACAACACTTTTTTTTTTCACCAATTGTGTCACTGGCTCTTATGTAACAATGTGGAGCCAATCAGGCCTTCACTAGTGTGCCAAAGCTGACCCAGGAGTGAACTGCTGGCAAACAGTGTGAGTAAGTGTTCATTTGGACCATCTGAATATTTACTGACCCCTCCTCTCAGACAAGTTCAATAACTTGTCCACCACCTGGCTCTATGTGCTCTTTTCTTACCCAAGAAAAAGAGTGAGAGGAAATATTGGGCTTATCTTTTGGGGCTTCAGATGTGACTTTAACATGAAGACTCTTATTAAAATAGTCTCGTGCTTTCTGATGATCTCACAGCTCACTGATGGAGCAACGTTT[C/T]AGGGAAATCGAGCAGGTGAGGGTCAATTACACTTGTCTTAAAGGGCTAGTAACCCCAAAATTGAAATAATACAATAATGTATTAATCATAAAGTTGTTTCAGACCAGTATAGCTTTCTTACTTTTGGAAAATATAACACGCACAATCAGTTGAAGTTACAATTATTAGTCCTCCTGTCGTATTTTAGTTCTTTTATATTTCCCCCAATTTCTGTTAAACAGACAGAATTTTTAAACACATTTCTCAACATAATAGTTAAAATAACTTATTTTTAAAAAATGATTTCTTTTATCTTTGCCATGATGACAGTTATATTTTACTAGATTTTTTTTCAACACACTAGTATTCAGCTCAAAGTGCAATTTAAAAGCTTAACTAGGTTAATTAGTTTAACTAGGCAGGTTAGTGTAATTAGGCAAGTTATTGTATAACAGTGGTTTGTTCTTTAGGCAATCAAAAAGAAATATTGCTTAAGGGGGCTAATAATATTGACCTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20975
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075508 Nonsense 118 514 3 9
ENSDART00000129385 Nonsense 118 514 4 10

The following transcripts of ENSDARG00000053476 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31733423)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30125765
GRCz11 7 30396915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGCACTGAAGAGCTCAGAGGGAAACATCAATGTGCTGATTGCAGATT[G/A]GCTGACTCTGGCACACCAGCACTATCCTATAGCAGCGCAGAACACACGAA
Long Flanking Sequence:
ATGACCATTCAAACAGACACTGAGCCTGAAGCCAAGATGAAGATGCGATATGAACCTAAATCAGTCTTCAGGGTTTACACTGATGGAGAATACATAGAGGATACATGCGCACTGGAGCTCTTCCAGCCTCACACACTGGACGCCTGTGGCTTCAACAGCAGCCTTCCTCTCGCTATCATCATTCATGGCTGGTCGGTATGTTGAGTTCATTGATCTAATAGAAAAACAGATCAATGGTTCAAACGAACAAAAGGTCACAGAGACCTTGGCACGGACTGCAAACAGCTAAGCAAAGTTATTTCACATCTGATAAAGGCAAAATTGATTTGACAAAAGTGCCTTAGCTGTGATTCAGCAGAAGGCTCACTAAAACAAAAAACGAAATGACAAATCCTCCACCCCTGTCCCGCAGGTAGACGGAATGATGGAGAAATGGATTTCTCGGCTGGCATCAGCACTGAAGAGCTCAGAGGGAAACATCAATGTGCTGATTGCAGATT[G/A]GCTGACTCTGGCACACCAGCACTATCCTATAGCAGCGCAGAACACACGAATAGTGGGACAGGACATTGCCCACCTGCTGAGCTGGCTAGAGGTGAGAATTCAAATCTCTACACAATATGACTGGACACTTAATTTTCAAATTTAATCAATTGTGCCTGCTCTACATATTATATATGAAACTGAAGGACTTTGAGTAGGATCTTTGTGTAGTAGAGTGTACGTACTGTACCGCTGTCCAGTGGTTTGAGGTCAATAAGCTTTTGTTCAATGTTTTTGAAAGAAGCATCTAATCTAAACAAATTTTCATTGATTACAAACGAACAGTATTACTGACAAATATTACAATATACACAACAGGGCTGTTGAATGGTTATTTTCTGGTTAGCTGATGAACATAGGTGTGCACAGTTAGGGAGATCCAGGTCTGATATTTTGATCATTTTCATAGAGGTCACTTTGTAAATAATGATTCCCCAGAGAACCCTTTAACCTCTTAAGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa189
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075508 Nonsense 205 514 5 9
ENSDART00000129385 Nonsense 205 514 6 10

The following transcripts of ENSDARG00000053476 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31735479)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30127821
GRCz11 7 30398971
KASP Assay ID:
554-0102.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGTTTGGATCCTGCCGGTCCGATGTTTGAGGGAATGTCTCATACTGAC[A/T]GACTCTCACCGGAAGATGCTAAGTTTGTGGATGCCATCCATACATTTACC
Long Flanking Sequence:
ATTTAGTATATTTGAAAGATGAAAAAAATGGACAGATGACAAAAGAATAAAACTCAGTACTAGTGAACCCTAGATTAAAGGATAGTCGTCAGGTATGAGGATAAAAAGTTTAATTAACTAGTATTTTGGAGCGGCACTGTCACTCTTTAATAAAATGATTCTTGTGTTTCCTAACAAGAGTTTTGGTATAGTATTTTTAGTATTCTAATTTAAGAAAAAAAAAACATGAAGACAAATAAATAATCAACATATTTAATTTATAAGTCTAATATAAAGCTGCATTACACTTTAAATAGATTTTATGCTTAATTCCCTTTCATTCACATAACAAGTTAAAAATACTTTCAACTCTAAGATGGTTATCTTCAGTAAATCATCTTAAACATGACAAATACACACTATATAATTCCTGCTCAGAGGTGAAAAAAAGTAACGTTTGTCTTATTGTTGTAGGTTTGGATCCTGCCGGTCCGATGTTTGAGGGAATGTCTCATACTGAC[A/T]GACTCTCACCGGAAGATGCTAAGTTTGTGGATGCCATCCATACATTTACCCTGCAGCGCATGGGACTCAGTGTGGGCATCAAACAGCCTGTGGCCCACTTTGATTTCTACCCCAATGGAGGATCATTTCAACCCGGATGCCAGCTGCACATGCAGAACATTTATGCACATTTAGCTCAGCACGGGATAATGGGTGAGTATCTCCGCTGAACAGACAGATGAATGAATGAGAGAAAGGCACAGGTTCATCCCCAGATGAATACCTAAAATGTCAGATTAGGATGAGACACATCCAAAACATCCTATTAATGACACTGCGAGAATGGCTAACCACTGAAGACAGCTTTCCAGATGAAAGGCAGAGACACATAAAAGCAGCTGTCATCCTAACAACTTAATTATTCCAAATCCCTCTTCTGTTCTGCTCTCCTACTGAGATATGCCTACAGGCAATTAAACACCCCTATGGGAAAAGCTGAAGCAGAAAGACAGGCCTTAAAA
Associated Phenotype:
Not determined