Busch Lab

ZMP

gtpbp1

Ensembl ID:
ENSDARG00000053467
ZFIN ID:
ZDB-GENE-030909-12
Description:
GTP-binding protein 1 [Source:RefSeq peptide;Acc:NP_998640]
Human Orthologue:
GTPBP1
Human Description:
GTP binding protein 1 [Source:HGNC Symbol;Acc:4669]
Mouse Orthologue:
Gtpbp1
Mouse Description:
GTP binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109443]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10030 Nonsense Available for shipment Available now
sa33222 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075501 Nonsense 118 642 3 12
ENSDART00000146005 Nonsense 133 657 3 12
Genomic Location (Zv9):
Chromosome 3 (position 33578205)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33312373
GRCz11 3 33444087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCCACAGTGAGGTCYATGTGTGAGCAGATYGAGGCGGACCTCATCTTGT[T/A]GAGAGAGCGCACTGAGGCTGGCGGCCAGGTCAGAGATTATCTGATTCGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26103
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075501 Nonsense 131 642 3 12
ENSDART00000146005 Nonsense 146 657 3 12
Genomic Location (Zv9):
Chromosome 3 (position 33578245)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33312413
GRCz11 3 33444127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATCTTGTTGAGAGAGCGCACTGAGGCTGGCGGCCAGGTCAGAGATTA[T/A]CTGATTCGTCGCCGGGTAGGAGAAGCAGACTTTTTAGAAGTTAGGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33222
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075501 Essential Splice Site 497 642 9 12
ENSDART00000146005 Essential Splice Site 512 657 9 12
Genomic Location (Zv9):
Chromosome 3 (position 33586103)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33320271
GRCz11 3 33451985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAGTTTTACATCACCCGACAACCATCTCACCTAGATATCAAGCAATGGG[T/C]GAGAGATATGCTCACCCTTGATAACTGTTGAATGCAAATATGTGAGATTT
Associated Phenotype:
Not determined