Busch Lab

ZMP

zgc:110196

Ensembl ID:
ENSDARG00000053466
ZFIN ID:
ZDB-GENE-050417-369
Description:
Transmembrane protein C3orf1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q568N3]
Human Orthologue:
C3orf1
Human Description:
chromosome 3 open reading frame 1 [Source:HGNC Symbol;Acc:1321]
Mouse Orthologue:
4930455C21Rik
Mouse Description:
RIKEN cDNA 4930455C21 gene Gene [Source:MGI Symbol;Acc:MGI:1922139]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10411 Nonsense Available for shipment Available now
sa18698 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075502 Nonsense 121 292 3 8
ENSDART00000075502 Nonsense 121 292 3 8
Genomic Location (Zv9):
Chromosome 1 (position 27787274)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28053022
GRCz11 1 28856374
KASP Assay ID:
2259-0654.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAGGCATGCTCGTCAGAGGTTTAWCCAGTGCAGCCAGGCTGAAATTTA[T/A]CGAAACAGAGTGGATGCGGTGGTAAGYTACAGGACAGAGCCTGAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18698
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075502 Nonsense 121 292 3 8
ENSDART00000075502 Nonsense 121 292 3 8
Genomic Location (Zv9):
Chromosome 1 (position 27787274)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28053022
GRCz11 1 28856374
KASP Assay ID:
2259-0654.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGGCATGCTCGTCAGAGGTTTATCCAGTGCAGCCAGGCTGAAATTTA[T/A]CGAAACAGAGTGGATGCGGTGGTAAGTTACAGGACAGAGCCTGAACATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25591
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075502 Essential Splice Site 128 292 3 8
Genomic Location (Zv9):
Chromosome 1 (position 27787251)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28052999
GRCz11 1 28856351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCCAGTGCAGCCAGGCTGAAATTTATCGAAACAGAGTGGATGCGGTGG[T/G]AAGTTACAGGACAGAGCCTGAACATTATTTTATTTTTTTGTTGTTGTTTT
Associated Phenotype:
Not determined