Busch Lab

ZMP

si:dkey-76b14.5

Ensembl ID:
ENSDARG00000053462
ZFIN ID:
ZDB-GENE-090311-30
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JKW3]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12561 Nonsense Available for shipment Available now
sa12520 Nonsense Available for shipment Available now
sa12380 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12561
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058210 None None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
ENSDART00000058210 None None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
Genomic Location (Zv9):
Chromosome 1 (position 56666208)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55450141
GRCz11 1 56119437
KASP Assay ID:
2259-1266.1 (used for ordering genotyping assays)
KASP Sequence:
CACWTCCTCAAATATTTTCTTTTGTCAGGTATTTGTTTGGTAATAAGGTG[C/T]GAGGAAGTGCATTTGTGGTGTTTGGRTTGGTGGAYGGTGAGAAGAAGATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058210 None None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
ENSDART00000058210 None None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
Genomic Location (Zv9):
Chromosome 1 (position 56666208)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55450141
GRCz11 1 56119437
KASP Assay ID:
2259-1266.1 (used for ordering genotyping assays)
KASP Sequence:
CACWTCCTCAAATATTTTCTTTTGTCAGGTATTTGTTTGGTAATAAGGTG[C/T]GAGGAAGTGCATTTGTGGTGTTTGGRTTGGTGGAYGGTGAGAAGAAGATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058210 Nonsense 203 204 5 5
ENSDART00000133079 Nonsense 469 628 11 14
Genomic Location (Zv9):
Chromosome 1 (position 56664010)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55447943
GRCz11 1 56117239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAMCTGAATCTGGGAAATGGTGCTGGAGTGGTGAACCAGGATTTCACATA[T/A]ATGGTGAGTAACGCATGACACCATTCAGGGCCAGAGTGGGACTCCTTTTC
Associated Phenotype:
Not determined