Busch Lab

ZMP

ENSDARG00000053454

Ensembl ID:
ENSDARG00000053454
Human Orthologues:
CNTN1, CNTN2, CNTN5
Human Descriptions:
contactin 1 [Source:HGNC Symbol;Acc:2171]
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
contactin 5 [Source:HGNC Symbol;Acc:2175]
Mouse Orthologues:
Cntn1, Cntn2, Cntn5
Mouse Descriptions:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]
contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa26814 Nonsense Mutation detected in F1 DNA Not yet available
sa9424 Essential Splice Site Available for shipment Available now
sa2281 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26815
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 60 1029 2 22
Genomic Location (Zv9):
Chromosome 6 (position 44627654)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44696225
GRCz11 6 44692165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCCATCTATTCCCCTCAACAAGAGGCTGTTTTAAGCTGTGAGGCGTCT[G/T]GAGCCCCTTCTCCTCAATACAGGTAGGAATGAGTCTAATCTAGCGTCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26814
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 247 1029 6 22
Genomic Location (Zv9):
Chromosome 6 (position 44586098)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44654669
GRCz11 6 44651188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACGAGCCTAAAATAGAGCTTCATTTCCCCGACACCATTCCAGCTGCT[A/T]AAGGATCCGCGCTGAAGCTCGAATGCTTCGCCTTGGGAAAGTAAGTCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9424
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Essential Splice Site 260 1029 7 22
Genomic Location (Zv9):
Chromosome 6 (position 44583409)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44651980
GRCz11 6 44648499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAAAAGTTTGACATYGATAACTAATTGTGGCCTTGTTCTGYTTAAAAC[A/T]GTCCAGTTCCTAGGATCAGCTGGAGAAGAACCAGTGACGTTTCMTTCCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26813
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 657 1029 15 22
Genomic Location (Zv9):
Chromosome 6 (position 44550348)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44618919
GRCz11 6 44615641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTATTTTACTTCAGTATATTTTTATTGTGTTTTGCTGTTCAGTTCCT[G/T]AGGTGATCAATGGAAACACTCTGACTGCGACGGTAGTGGGTTTGAACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2281
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055035 Nonsense 865 1029 19 22
Genomic Location (Zv9):
Chromosome 6 (position 44532199)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44600770
GRCz11 6 44597659
KASP Assay ID:
554-2436.1 (used for ordering genotyping assays)
KASP Sequence:
GATGACACCAAGCCGGATACAGTGGGTAAAGTTCGAATCACTGGAAACTA[C/A]ACAGCAGTGAATGTCAGCGGCCTGCAGGGGAACACTCAATATTACCTRGC
Associated Phenotype:
Not determined