Busch Lab

ZMP

si:ch211-251f6.4

Ensembl ID:
ENSDARG00000053443
ZFIN ID:
ZDB-GENE-091204-90
Human Orthologue:
PSTPIP2
Human Description:
proline-serine-threonine phosphatase interacting protein 2 [Source:HGNC Symbol;Acc:9581]
Mouse Orthologue:
Pstpip2
Mouse Description:
proline-serine-threonine phosphatase-interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1335088]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18976 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6160 Nonsense Mutation detected in F1 DNA Not yet available
sa21656 Essential Splice Site Available for shipment Available now
sa21655 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Essential Splice Site 117 206 5 8
ENSDART00000138875 Essential Splice Site 129 198 5 8
Genomic Location (Zv9):
Chromosome 10 (position 7135475)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8148275
GRCz11 10 8106975
KASP Assay ID:
2261-7167.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAAAATTAGAAGACTTCAGAGAGAAACAGAAAGAGGCCCGGAAAAAGG[T/C]AAGAGCATTTCATACCTTTTTAATTGATTTAAAGTGTGTTATTTGTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6160
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Nonsense 145 206 7 8
ENSDART00000138875 Nonsense 157 198 7 8
Genomic Location (Zv9):
Chromosome 10 (position 7155614)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8168414
GRCz11 10 8127114
KASP Assay ID:
554-4752.1 (used for ordering genotyping assays)
KASP Sequence:
ACTTTTTAAAATGTCAGTCATTGTCTTTTAAGGCAAAGAAGAGCTACGAT[C/T]AAAAATGCAGAGACAAAGAGGAAACAGAGCAGAACATGAACAGAAGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
Genomic Location (Zv9):
Chromosome 10 (position 7155695)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8168495
GRCz11 10 8127195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACATGAACAGAAGTGCCACCACTTGCAGTGCCAAGCAGCAAGAAAAG[G/T]TACATAAATATAACTGTGAGAAAGAATCATGCTTTCTTTTAAATTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21655
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
ENSDART00000075474 Essential Splice Site 171 206 7 8
ENSDART00000138875 Essential Splice Site 183 198 7 8
Genomic Location (Zv9):
Chromosome 10 (position 7155695)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8168495
GRCz11 10 8127195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACATGAACAGAAGTGCCACCACTTGCAGTGCCAAGCAGCAAGAAAAG[G/T]TACATAAATATAACTGTGAGAAAGAATCATGCTTTCTTTTAAATTTGCTT
Associated Phenotype:
Not determined