Busch Lab

ZMP

LOC569359

Ensembl ID:
ENSDARG00000053389
Human Orthologue:
PHF15
Human Description:
PHD finger protein 15 [Source:HGNC Symbol;Acc:22984]
Mouse Orthologue:
Phf15
Mouse Description:
PHD finger protein 15 Gene [Source:MGI Symbol;Acc:MGI:1924151]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4971
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075432 Nonsense 82 795 3 11
Genomic Location (Zv9):
Chromosome 21 (position 44074177)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45348289
GRCz11 21 45389100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCACAGCTGAGCGCAGACGAGTTCTACATTCTGTGCGACCCCTGGAGG[C/T]AGGAGTGGGAGAAGGGCGTTCAGGTGCCAGCCAACGTGGAGACCATTCCT
Associated Phenotype:
Not determined