Busch Lab

ZMP

ftr12

Ensembl ID:
ENSDARG00000053366
ZFIN ID:
ZDB-GENE-070912-196
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S539]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44544 Nonsense Mutation detected in F1 DNA Not yet available
sa19847 Nonsense Available for shipment Available now
sa15836 Nonsense Available for shipment Available now
sa39910 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44544
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Nonsense 119 547 1 6
ENSDART00000143419 Nonsense 119 291 1 3
Genomic Location (Zv9):
Chromosome 2 (position 42817469)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42866933
GRCz11 2 42716351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTTTGTACTGGAGATAAAAATAAAGCCATCAAGTCGTGTCTGGTGTG[T/A]CTGAACTCTTACTGCCAAAATCATCTTGAACAACACGAGAGTTTCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Nonsense 136 547 1 6
ENSDART00000143419 Nonsense 136 291 1 3
Genomic Location (Zv9):
Chromosome 2 (position 42817518)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42866982
GRCz11 2 42716400
KASP Assay ID:
2259-2505.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGAACTCTTACTGCCAAAATCATCTTGAACAACACGAGAGTTTCTTC[A/T]GAGGTAAAAGACACAATCTGATGGACGCCACTGGACGACTGCAGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15836
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Nonsense 214 547 2 6
ENSDART00000143419 Nonsense 214 291 2 3
Genomic Location (Zv9):
Chromosome 2 (position 42817884)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42867348
GRCz11 2 42716766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGTCAGTTGGCTGAGATGCNARAAAACAACCCATCAGCRAATCGAGGRG[A/T]AACAAAAGGAGTGTGWGGAGCTGAGAGAGGCTGTTGAGTCTYACAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39910
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Essential Splice Site 380 547 5 6
ENSDART00000143419 None None 291 None 3
Genomic Location (Zv9):
Chromosome 2 (position 42819336)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42868800
GRCz11 2 42718218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACATAATTCCCACCTCTGAGCCAGAGACAATTGAGCAGTTCCAACAAT[G/T]TAAGTCTTTATCTCGAAATATAGAAACCTACATGCAATAGCTCTGGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25884
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056161 Nonsense 384 547 6 6
ENSDART00000143419 None None 291 None 3
Genomic Location (Zv9):
Chromosome 2 (position 42819446)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42868910
GRCz11 2 42718328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTAAAAGTCAGATGGATATTATGCGTTTTATCTTCACCAGATTCCCGT[C/T]AGTTCACTTTGGATCCAAACACAGTGAATAATTACCTGGTGCTATCTGAA
Associated Phenotype:
Not determined