Busch Lab

ZMP

Q5BLC3_DANRE

Ensembl ID:
ENSDARG00000053362
Description:
CILP protein [Source:UniProtKB/TrEMBL;Acc:Q5BLC3]
Human Orthologue:
CILP
Human Description:
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase [Source:HGNC Symbol;Acc:1980]
Mouse Orthologue:
Cilp
Mouse Description:
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40928 Nonsense Mutation detected in F1 DNA Not yet available
sa7599 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40928
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075398 Nonsense 71 1171 3 8
Genomic Location (Zv9):
Chromosome 7 (position 32772084)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31166424
GRCz11 7 31437574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCACCCTGGTGGGAAAGGAGATTATGAGAAGCTGAATGTAATTCGTTA[T/G]TATTATCGAGCCCGTGTGTGTGAGGTTCCTCGAGCTCTGGAGGCACGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26978
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075398 Nonsense 120 1171 3 8
Genomic Location (Zv9):
Chromosome 7 (position 32771939)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31166279
GRCz11 7 31437429
KASP Assay ID:
2259-9034.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACCCAGCGGTGGGCTTCTGGTGTGTCAATGATGAACAGCCTTTTGGG[A/T]AGAACTGCTCAAACTATGCTGTACGCTTCCTCTGTCCCAGAGGTAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7599
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075398 Missense 244 1171 5 8
Genomic Location (Zv9):
Chromosome 7 (position 32770276)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31164616
GRCz11 7 31435766
KASP Assay ID:
554-4256.1 (used for ordering genotyping assays)
KASP Sequence:
TCCCTGCACCTGGAGCTGCAATCCTGCGTGCTGGWTCCAGCMCCAAACTC[C/T]TCACTGTTACTGATCAYAATGGACACTTCCAAGTCCCTGGAATCTGCCCT
Associated Phenotype:
Not determined