Busch Lab

ZMP

map3k4

Ensembl ID:
ENSDARG00000053303
ZFIN IDs:
ZDB-GENE-090313-125, ZDB-GENE-990603-4, ZDB-GENE-990603-4
Description:
Novel protein similar to H.sapiens MAP3K4, mitogen-activated protein kinase kinase kinase 4 (MAP3K4)
Human Orthologue:
MAP3K4
Human Description:
mitogen-activated protein kinase kinase kinase 4 [Source:HGNC Symbol;Acc:6856]
Mouse Orthologue:
Map3k4
Mouse Description:
mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42251 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42250 Nonsense Mutation detected in F1 DNA Not yet available
sa1374 Nonsense Available for shipment Available now
sa11281 Nonsense Available for shipment Available now
sa22347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42251
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Essential Splice Site 32 1488 1 30
ENSDART00000137256 Essential Splice Site 66 770 2 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36228268)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35700834
GRCz11 13 35826666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTTTGTCCATCAAACACCAGAGAAGCAACCCGGGGTCAAAGGGCAAAG[G/A]TGAGAACCCTTAACTTTGCAAGTCTCCCAAACATATGGTGCTGGGGCCCC
Long Flanking Sequence:
ATAAACCTGTCTGGATAAATGTTGTTTAGTCTAATTTTCATTTTATGCTCTCAAAGTGTCTATATAGGCTAAAAAATATATATTGATTGCAAATCCTGAGAAAGTGATCTCTAATTTATTTAAATGTCTGTATAAGAGCTGAGCAGTATTCTCAAGATACTTTGAAAGAATTTTGATCTATTTTTTTCTTAGCTGTGCAGACACAACGTCATTCTTGACCTTGCTGCGCATTCAGTTTCTTAAAGTTTCCCATTCTGATGTGAAGTGTAGGAAAATGCTTCATTGCCGTAATCATTTTGTGTGGTTGTTGTGTTTTTTGTTTAGGCTCAAGGACTCGTCCAAAGATGATCACCAGCAGATCACTGAGGTGGATGAGTCTTGGGACGAGCCCGGCCAGGAAGAGGAGACTCTCTACTGCACCTCCCCTCCCCAAACTCCTCGCCAGATAAAACGTTTGTCCATCAAACACCAGAGAAGCAACCCGGGGTCAAAGGGCAAAG[G/A]TGAGAACCCTTAACTTTGCAAGTCTCCCAAACATATGGTGCTGGGGCCCCAATACTATCAGTGGCACACAGCCATTGTTCTGGCGGGATTTTCTAGCTCTTGAATGAAAGTTATTGCATTTGAAAGTTATAGAGAAATATTTTGCTATGAACAGATAATTTGGTATTTAACTTAAACTCTAAGAAAACATAATAGTACGATAGTCCAGCGGTTGATAGCCTTTTCATCAAAGAAAAAGTCAACTATTTCAGCTTTTTCACTATTATTAGTTGTTTTAACTGAAAAAACAAACATTGGAAAAACCTTCTCCAATGTAAACAAAATAGCAACATACAATACTATTCATTAGGTGATTTATTTGTCAGAGGGTTTCACTGTCAATTGAACTCAAGCATGTGTCAGTCTTTTTCTGTATATTGTATTGTATTAAATTAATGACTGAATGAAAATCTGGTCAAATTGTAATACATCTAGCAGAAAAATGAAATACAGTGGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42250
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 53 1488 3 30
ENSDART00000137256 Nonsense 87 770 3 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36226953)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35699519
GRCz11 13 35825351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCATCCAGCCCCTTGTCTCAGCGTGAGCGTGAGGGAGCCAGATCAGCC[G/T]AACCTCCTGAAGAGCACAGCTACAAGCAGGAAAAGAAGCAGCGCTTCAAC
Long Flanking Sequence:
CTGCTGGACCAACAGCTCTGCACATTTTCCATGTCTCCTTAAACGAACACACCTGATTCAGATCATCAGCTCTTAGCAGAGACTGAAACCCTTGTAATGGGTGTAACAGACAAAGGAGAACTTGTAACATATTTGTAACAGCAAAATATGCAGTGTTGATGGTCCTCCAGGAATGTGGTTGAGAAACACTGTGCTTAAGGATCAGAGAAGTTACGAGAGTAAAGTGTGTAGTGAAGGGTTTTACAGCTTTAAAACAACTATAATAATTGTCAAAAACAAAGCGGACTACTTTGTGGATTTCACATTTTGAGGGCTATTCTAGAATCCCTGTGATTATTTAGGGACCTGTGAATTGCAATGTCAGATTTTTCCAGTTTTGTGCAGCCATTTTTTTAAATTTATTTGTTATCTGTCACTGACTTTTGTCTCTTTCACCAACAGAGAAGTCGTGTTCATCCAGCCCCTTGTCTCAGCGTGAGCGTGAGGGAGCCAGATCAGCC[G/T]AACCTCCTGAAGAGCACAGCTACAAGCAGGAAAAGAAGCAGCGCTTCAACCAGCGATCCAGCGAGCGGGACGTCAAGAAGAAGTTTGAAGGCGCCTTTATGCTGGATCCTGTTTCCAAGTCCAGTACCATCGGCTCCAGAAACATGGATCCCCGCAAGCCCTACCTGAGTCTGGGCATGATCCCCGTTCGCACCCATCGGCAAACTTCGCGCACAGACTGTCCTGCAGACCGCCTTAAGTTCTTCGAGACCCTGCGGTTGCTGCTTAAACTCACCTCCATGTCATCCAAGAAGAAGGAGAAGGAGCAGCGAGGTCTGGAGAACACCGCTTATATGGAGCAGAACAACGAGGTCATCTGGCTGGAGCTGCAGGCCTGGCACGCTCGCCGTAGTGTTAATGACCAGGACCTGTACCTGTTCACCGCTCGACAACACATACCTGACATCATCAGCGAGGTTTTGCACTTCAAAGTGGACTACAGTAGCCTGTGTGGACTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1374
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 196 1488 3 30
ENSDART00000137256 Nonsense 230 770 3 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36226524)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35699090
GRCz11 13 35824922
KASP Assay ID:
554-1286.1 (used for ordering genotyping assays)
KASP Sequence:
ACGCTCGCCGTAGTGTTAATGACCAGGACCTGTACCTGTTYACCGCTCGA[C/T]AACACATACCTGACATYATCAGCGAGGTTTTGCACTTCAAAGTGGACTAC
Long Flanking Sequence:
TTTCACCAACAGAGAAGTCGTGTTCATCCAGCCCCTTGTCTCAGCGTGAGCGTGAGGGAGCCAGATCAGCCGAACCTCCTGAAGAGCACAGCTACAAGCAGGAAAAGAAGCAGCGCTTCAACCAGCGATCCAGCGAGCGGGACGTCAAGAAGAAGTTTGAAGGCGCCTTTATGCTGGATCCTGTTTCCAAGTCCAGTACCATCGGCTCCAGAAACATGGATCCCCGCAAGCCCTACCTGAGTCTGGGCATGATCCCCGTTCGCACCCATCGGCAAACTTCGCGCACAGACTGTCCTGCAGACCGCCTTAAGTTCTTCGAGACCCTGCGGTTGCTGCTTAAACTCACCTCCATGTCATCCAAGAAGAAGGAGAAGGAGCAGCGAGGTCTGGAGAACACCGCTTATATGGAGCAGAACAACGAGGTCATCTGGCTGGAGCTGCAGGCCTGGCACGCTCGCCGTAGTGTTAATGACCAGGACCTGTACCTGTTCACCGCTCGA[C/T]AACACATACCTGACATCATCAGCGAGGTTTTGCACTTCAAAGTGGACTACAGTAGCCTGTGTGGACTCGAGAGTGGCGCCTCTGTTGAGGAGAGCAACTCCTGTCCTGGTGAAACTAATTGCATGGACGATCCATTTAGCTTTAGCACATGTTCCGCGTCCTGGCAGGAAATTGATGCCGCTGCTCCTTTTTCTTCAGGGCTGGAGTGCCGCAACCACCTGCAAAGGCAGCGAGTAGCTTTCGATCAGGTAAAACGGGTCATGTCGCTGTTAGAGTCGGTGGAGGCTTTGTACCCTTCTCTGCAAACCTTGCAGAAGGACTATGAGAAGTATGCAGCTCGGGACTTCCAGGGCAGGGTGCAGGCGCTCTGCTTATGGCTCAACATCACTCAGGACCTGAACCAGAAACTGCGCGTGATGGGCACCGTGCTGGGCCTCAGGGACCTTTCCCGCATCGGCTGGCCCATCTTTGAGATTCCATCACCTCGCTGCTCTCGAGGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 599 1488 7 30
ENSDART00000137256 Nonsense 659 770 6 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36219921)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35692487
GRCz11 13 35818319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTCACRCAGGTGTACTTTGACTACATGCGCAGCTGGATCCAGATGTTA[C/T]AGCAGCTTYCTCAAGCRTCCCACAGCCTGAAGAACCTGCTGGAGGAGGAA
Long Flanking Sequence:
TCACTAAACTGAACTTCAACTCTGAAAACTGGACTGACACAGTTTCAATATACTAGAACTTCCATGTTAAGCTGATTTAACACAATCTACATTGTAAAACACATAGAAATAAAGATGAATATTCAATTCATGAATATTCACAAATTATGACATTGCTTACTATAAGATTGTTACAGTGTATTTGTGACTCAGTGGGTGCTTTGTGTTTCACTGCCAAGATATTTTTATTTGCCCAGCTGTGTGCTTTTTAACGTTTAGTTTTTTTTTTTTTGCATGCGAGTAATTAGAGAAAATAACTTCTGATGAAATATTAGCGATCAAAGTTTTAAGCAAATCTGTAAAAATAAGATTTATACTTCAGCTGTAAAAGCAGTTGGACAAATCCCGGTATTTCTCCCTCACGAACAGCAGTGATCTGAATAGACAGACAGTAAATCTTCGGTGTGTCTGTGTTCACACAGGTGTACTTTGACTACATGCGCAGCTGGATCCAGATGTTA[C/T]AGCAGCTTCCTCAAGCATCCCACAGCCTGAAGAACCTGCTGGAGGAGGAATGGAACTTTACCAAAGTCATCACTCCATACATCCGAGGCGGAGAAGCCCAGTCTGGGAAGCTCTTCTGGTTGGTATTTTCAATCTGTGCGCTTGCTGTATAAAGGACAAATGACAAATAAATGTTGAAGTATTATACAATGTATTTGGTTTCTGTTCTACTAGAGGAATTACAGACATAAATTCAAAAAAAAAAAAAAAAAAAAACTGTTTAGAGTCAACATACTCCTTCATATAATAATTCACTATTTAAAATGGGACTTGACAGCAAGTAGCTAGAATGTATGAAGAAGATTTTTAGCTTGCCTATTGAGGAGAAACTTCACAAATTTGCTGCCCAAATATTTTTGTTGAAACTCATTTTTTTTTTTGTCTATTGTGTGTCTATGGGTATTTGGGCAATTTTGGGAATTTATTAAGGCAAGGATGTTCAAACTTGGTTCTGGAGGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Nonsense 1224 1488 23 30
ENSDART00000137256 None None 770 None 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36202868)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35675544
GRCz11 13 35801376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACGATAACGTGATGCATGTGGGCCTGCGCAAAGTCACCTTTAAATGG[C/T]AGAGAGGAAACAAGATCGGTGAGTGAACAGCAGTGTGCATATGACGAAAC
Long Flanking Sequence:
ATAATTATCCAAAAATGTAATTGTCAAATAAATAAATATTTTAATTTGTAATAGTTTTACATTATTAATGCCTTGACTGTATTTTTGTTAAATTATTGCAGCCTTGCTATAAGCAGAAGATACTTTTAAATATTCCACATTATGAACTTTAAACTTTGACATGTTTTATAAAAAAAAATCATACTCAACCCTGAGACTGCAGTGACTAAACAGATGTTTCAATTGTTTTTAATGGATTCACATAAATGCACTGTTTTCTGAATCTGTTTTATTTATATTAAAATGTGCGTAATCTCTGAAATGGATCTTCTGCTCTTGTTTGTCCTGCAGACACAGCGCGTCAGAGCCCCCTGGAGGCAGTGCGGCGCTCCATACAAACCTTCGATGAGAAACACTATGCGCTTATGAGACAGAGAAACATCATTGGACAGGTTTGCAACACGCCGAAGTCCTACGATAACGTGATGCATGTGGGCCTGCGCAAAGTCACCTTTAAATGG[C/T]AGAGAGGAAACAAGATCGGTGAGTGAACAGCAGTGTGCATATGACGAAACGCCGCACAGGCTAGTTTCCTGAACACTGTTTCTGGCTGACAGGTGAAGGGCAGTATGGGAAGGTTTACACATGCATCAATGTGGACACTGGTGAACTAATGGCCATGAAGGAGGTATGTAAAGTATCAGCTATATAAACGTGTATAATTATTTATATTTTACAGTAACATTATTAATTTGTTATTAGCATTAGCTTAGCTAACACAAACCAGTAATGAGAATCTGGCATTTGTTAACCTTTTGTTAATGTTAGTAAATGAAAATGTTCAAATGTTGAGATTAATGTTAAGATAATCAATGCTACTGTCTAGAAGTATTGCCTACTGTTAGTTCTTGTTAATTAATTTGAACTGTAAATTGAAACCATTTTAGCTTTTTACACTTGAAGAGTTCAGATGCAGAAGCTGTTAAACGCCACTTCCGCCAAAAATGAGATAATGACATTGAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2719
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075333 Essential Splice Site 1422 1488 28 30
ENSDART00000137256 None None 770 None 8

The following transcripts of ENSDARG00000053303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36197547)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35670223
GRCz11 13 35796055
KASP Assay ID:
554-3418.1 (used for ordering genotyping assays)
KASP Sequence:
TGATATCTGGAGTCTCGGTTGTGTTCTCATAGAAATGGTCACTGGAAAGG[T/C]AAAGTCTGCTTGTTTATGCATGCCTTTNGAGCTTTGTTCTTTATTCATTT
Long Flanking Sequence:
ATGGCATCTCACATTTGACTGATATTACAATATCTCATGATTAAAGGTCACTTGACATAACCAAACACCTCCTGGAATTCTTTAGCATGGTATGAAAGTTTCAAAAGGTCTCATAATAAAATATAATATAATATAATATAATTAAATTAGCAATTTAGTCAAAGTGGGAAAAAATACTGAGAAAAGGTTTAGTTTTAAAAATATAAATGGCCAATTAGCATTTAATAAACATATAGCTTTCATGTCAGATCAACAGTCTACATTAATGTAGTCTACTACAATTTACTTTTTTTTTATTATTAATCAAAAATGAACTTGTCAGTTTAATTAAACGTATTTCCATTTAATAACACCACATAACACAGACCCACTCTTCTTTCTGTGGTTTCCAGCATACATGGCTCCTGAGGTGATCACCAGAGCGAAGGGTGAAGGTCACGGTCGAGCTGCTGATATCTGGAGTCTCGGTTGTGTTCTCATAGAAATGGTCACTGGAAAGG[T/C]AAAGTCTGCTTGTTTATGCATGCCTTTTGAGCTTTGTTCTTTATTCATTTACGTGCCAGCGCTTCCTCAAACTTCTCAACTGTTGTCAAAACATGCTGGGTTTAGTCCTGAAAGGAATTATTTGTTGGGCTTGCCTCCACACGTCTCCACAACTGGTGCTTTTAAAAAGAGCTTTAAACGCAGTAAAAATGTCCACTAATTATGATGACAAACCACTCAACTCATTAAATACTCAGTTTTAAAGGAGCCATAGAATGAAAATCTGAATGTACATAGGCATACAGTAGCTGAATATTAAGATTTCCGTTCATGCTAATGACATACCATGAGCTTCACACATTGTTTCCTCATTCTCATGTAAATCCTGTGTGTAAAATCCCAATATAAAAAAAGAACAAACTCTTCATGATCTACATGGCATTATTAATATGCATCCTCCAGGCAGGGTTTGATTGGCCTTTTTGATTAGAAGTGTCAGTGGTGTAAAGTAACTAATTACA
Associated Phenotype:
Not determined