Busch Lab

ZMP

insm1b

Ensembl ID:
ENSDARG00000053301
ZFIN ID:
ZDB-GENE-030131-2602
Description:
insulinoma-associated 1 [Source:RefSeq peptide;Acc:NP_955952]
Human Orthologue:
INSM1
Human Description:
insulinoma-associated 1 [Source:HGNC Symbol;Acc:6090]
Mouse Orthologue:
Insm1
Mouse Description:
insulinoma-associated 1 Gene [Source:MGI Symbol;Acc:MGI:1859980]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13938 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa204
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075331 Nonsense 273 453 1 1
Genomic Location (Zv9):
Chromosome 17 (position 41580578)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41475988
GRCz11 17 41464862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCGAGAAAGTCTTCAGCTGTCCGGCGAACCTGGCCTCCCACCGGCGCT[G/A]GCACAAACCGCGCGTGCAGAGCGCGCCGAAACAAGCCCTCCAACCCGCCA
Long Flanking Sequence:
CTCGCCCATCTCTGCCGAATCTTTCCCGACTCCCGCCTCTCTCACCAGCCTGGACCATCATCTTCTGTTCGCGCCGGTCGACTTGAAAATCGGCACCAGTAACAGTAACCGGAGCGGAACAGCCAGCGGCGCTCACGCCCCCGCCATCCAGACCGGAGCCAAAAGACCTTCCGCTGACGCCGCCGAGCGTAAAGTCAGCAGCAAAAGCGCCAAGAAACCCAAAGCCATACGCAAGCTCAACTTCGAGGACGAGGTAACTACATCCCCGGTGCTGGGCCTAAAAATCAAAGAGGGGCCCGTGGACCTGAAGCCCCGACCGTCTTCGGGTGGCACCAACAAGCCTCTGGGAGAGTTCATCTGCCAGCTTTGCAAAGAAGAATACTCGGACCCGTTCTCTCTGGCACAGCACAAATGCTCACGGATAGTGCGGGTGGAGTACAGGTGTCCCGAGTGCGAGAAAGTCTTCAGCTGTCCGGCGAACCTGGCCTCCCACCGGCGCT[G/A]GCACAAACCGCGCGTGCAGAGCGCGCCGAAACAAGCCCTCCAACCCGCCAAGCCTTTCCCCGAAGAGCTGAGAGCCGAGTTCCCCAGCGACAGAGACACCCCGAGCCCGGGTCTGTCTGAATCCGGCTCCGAGGACGGGCTCTACGACTGCCAACACTGCGGGAAGAGATTCAAACGCCAAGCGTACCTGAGGAAGCACATCCTGGGACACCAAGCGCTCCAAAATCAAATCCTCGGGGAGGCTTTTCGCAGCGCGGAAAGCCCCGACGCTATGCCTTCGGAGGACCGCCAAAGCCCAGCTCCGCTCAATCTGAGCCCCGCGGACTGTCTCACGTGCCCGGCTTGCGGAGAGAAGCTCCCCAACCGGGCGAGTCTGGAGCGACACCTGCGTCTCCTGCACGACGACGCCCAGGCGTTTCCCTGCAAGTTCTGCCCTGCCACTTTCTACAGCTCGCCGGGTCTCACCAGGCACATCAACAAATGCCACCCCACCGAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13938
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075331 Nonsense 290 453 1 1
Genomic Location (Zv9):
Chromosome 17 (position 41580628)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41476038
GRCz11 17 41464912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCACAAACCGCGCGTGCAGAGCGCGCCGAAACAAGCCCTCCAACCCGCC[A/T]AGCCTTTCCCCGAAGAGCTGAGAGCCGAGTTCCCCAGCGACAGAGACACC
Long Flanking Sequence:
TGGACCATCATCTTCTGTTCGCGCCGGTCGACTTGAAAATCGGCACCAGTAACAGTAACCGGAGCGGAACAGCCAGCGGCGCTCACGCCCCCGCCATCCAGACCGGAGCCAAAAGACCTTCCGCTGACGCCGCCGAGCGTAAAGTCAGCAGCAAAAGCGCCAAGAAACCCAAAGCCATACGCAAGCTCAACTTCGAGGACGAGGTAACTACATCCCCGGTGCTGGGCCTAAAAATCAAAGAGGGGCCCGTGGACCTGAAGCCCCGACCGTCTTCGGGTGGCACCAACAAGCCTCTGGGAGAGTTCATCTGCCAGCTTTGCAAAGAAGAATACTCGGACCCGTTCTCTCTGGCACAGCACAAATGCTCACGGATAGTGCGGGTGGAGTACAGGTGTCCCGAGTGCGAGAAAGTCTTCAGCTGTCCGGCGAACCTGGCCTCCCACCGGCGCTGGCACAAACCGCGCGTGCAGAGCGCGCCGAAACAAGCCCTCCAACCCGCC[A/T]AGCCTTTCCCCGAAGAGCTGAGAGCCGAGTTCCCCAGCGACAGAGACACCCCGAGCCCGGGTCTGTCTGAATCCGGCTCCGAGGACGGGCTCTACGACTGCCAACACTGCGGGAAGAGATTCAAACGCCAAGCGTACCTGAGGAAGCACATCCTGGGACACCAAGCGCTCCAAAATCAAATCCTCGGGGAGGCTTTTCGCAGCGCGGAAAGCCCCGACGCTATGCCTTCGGAGGACCGCCAAAGCCCAGCTCCGCTCAATCTGAGCCCCGCGGACTGTCTCACGTGCCCGGCTTGCGGAGAGAAGCTCCCCAACCGGGCGAGTCTGGAGCGACACCTGCGTCTCCTGCACGACGACGCCCAGGCGTTTCCCTGCAAGTTCTGCCCTGCCACTTTCTACAGCTCGCCGGGTCTCACCAGGCACATCAACAAATGCCACCCCACCGAAAACAGACAAGTCATCCTGCTCCAGATGCCCGTACGTAACGCCTGCTGAAGAAGA
Associated Phenotype:
Not determined