Busch Lab

ZMP

LOC100333141

Ensembl ID:
ENSDARG00000053219
Human Orthologue:
PPIC
Human Description:
peptidylprolyl isomerase C (cyclophilin C) [Source:HGNC Symbol;Acc:9256]
Mouse Orthologue:
Ppic
Mouse Description:
peptidylprolyl isomerase C Gene [Source:MGI Symbol;Acc:MGI:97751]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24822 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24822
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055579 Essential Splice Site 141 245 3 5
Genomic Location (Zv9):
Chromosome Zv9_NA783 (position 21030)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150596.1 21030
GRCz11 KN150596.1 21030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTTCATGATCCAGGGAGGAGATTTCACTGCTGGAGACGGAACAGGGG[G/A]TGAGGATCATGATCTCCTGGATTTTGAAAATTAGTAATTATTTCCATAAT
Long Flanking Sequence:
TCCAAAACATTCCCTCTGCTGTCCTTAAAGCACATTTGAACTCATTTGGCAGTGTAATTTGGCTATAATTCAGCCAAATCAGATGAAAATTATGTATTTATTTATTATTTTTAGTTGTGAATTCACTTCAGGAAAACACATTATTTTAAATGTAGAAATTGCACTAAGACAGAAATTAAGTGTGATAAAAGATAAAAATGAATAAATTGGAAATAAATAAATAAAACTACAAAGGGTGGGTATTAGGACTGTTGGCTGGAATTTCTAAGGGCCTCCAAATGACTAAATCCACCCCAATTATATTACTGTAAAGCATCCTGTAGAAAATATGAATGTGAAAGAGAGATCTGTGACGGGTGTGTGTGTGCATAACACAGATCATCTCTCTCTCTCTCCATCTCTCCAGAAGGGTTACGGCTATAAAGGCAGCAAGTTTCACAGAGTTATCAAAGATTTCATGATCCAGGGAGGAGATTTCACTGCTGGAGACGGAACAGGGG[G/A]TGAGGATCATGATCTCCTGGATTTTGAAAATTAGTAATTATTTCCATAATGAGCCATTCAAGTCAGCAGGTGAAAATGTATTCATATTGCAGTTCATTCATTCATTGGCTCAGTCCATTTATTTATCAGGTGTCACAACAGCGCAAATAACTGCCTACTTATCCAGCATACATTTTATACAGCTGATGCCCTTTCAGTTGCAACCCAGTACTGGGAAACACCCATACACTTATATTCAAACACATATTCTAGGGACAATTTAGCTTACCCAATTCCCCTATAGCACATGTCTTTGGACTTGTGGGGGAAACCAGAGCACGGAAACCCACACCAACACCAACATGCAAACTCCACACAGAAACACCAACTGACCCAACCAAGGCTCAAACCAGTGACCTTCTTGCTGTGAGGCGACAGCACTACCTACTCCGCCACAGCTAATGTTTACGTTTGTAATTTTTAAAATGATTTGCCAATTACAAACCACCTATATAACTCTG
Associated Phenotype:
Not determined