Busch Lab

ZMP

dis3l

Ensembl ID:
ENSDARG00000053200
ZFIN ID:
ZDB-GENE-070209-95
Description:
DIS3-like exonuclease 1 [Source:UniProtKB/Swiss-Prot;Acc:A2RV18]
Human Orthologue:
DIS3L
Human Description:
DIS3 mitotic control homolog (S. cerevisiae)-like [Source:HGNC Symbol;Acc:28698]
Mouse Orthologue:
Dis3l
Mouse Description:
DIS3 mitotic control homolog (S. cerevisiae)-like Gene [Source:MGI Symbol;Acc:MGI:2143272]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20997 Nonsense Available for shipment Available now
sa12925 Nonsense Available for shipment Available now
sa10294 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075176 Nonsense 120 1057 3 17
Genomic Location (Zv9):
Chromosome 7 (position 35597389)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33983004
GRCz11 7 34254154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGAAGGATCCTCGTCACGATTGTGTGCTCTTTGCCAATGAGTTTCAG[C/T]AATACTCCTACTGCCCCAGAGAAAAGGGTGAGTCCCAGGACAAATGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12925
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075176 Nonsense 281 1057 7 17
Genomic Location (Zv9):
Chromosome 7 (position 35594726)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33980341
GRCz11 7 34251491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCAGAGCKCAACAGTGATGTGCTAATCAATGGYGCAAAACATCGCAAT[C/T]GAGCCGTGCAYGGAGATGTGGTTGTCATTGAGCTGTTKCCCCGTAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10294
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075176 Nonsense 586 1057 12 17
Genomic Location (Zv9):
Chromosome 7 (position 35589906)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33975521
GRCz11 7 34246671
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGTCTGGTTTGGCCGTACTCTCATCCGCTCCTCGTATCAGCTTCACTAT[G/T]AGCTGGCCCAGAGCCTGCTGAATGGGGAGGAGGTTGAGGTACCTGAGCTA
Associated Phenotype:
Not determined