Busch Lab

ZMP

mtor

Ensembl ID:
ENSDARG00000053196
ZFIN ID:
ZDB-GENE-030131-2974
Description:
serine/threonine-protein kinase mTOR [Source:RefSeq peptide;Acc:NP_001070679]
Human Orthologue:
MTOR
Human Description:
mechanistic target of rapamycin (serine/threonine kinase) [Source:HGNC Symbol;Acc:3942]
Mouse Orthologue:
Mtor
Mouse Description:
mechanistic target of rapamycin (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI:1928394]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa38710 Nonsense Mutation detected in F1 DNA Not yet available
sa21374 Essential Splice Site Available for shipment Available now
sa16755 Nonsense Available for shipment Available now
sa34485 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31678 Nonsense Available for shipment Available now
sa30906 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41292 Nonsense Mutation detected in F1 DNA Not yet available
sa11792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38710
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 420 2515 9 58
ENSDART00000122801 Nonsense 420 2563 9 58
Genomic Location (Zv9):
Chromosome 8 (position 48456484)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46294742
GRCz11 8 46302621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCACCTGCTGGGCTGCCTAAAAAAAGAAAAGGAGCGGACGGCAGCATTT[C/T]AAGCGCTGGGGCTACTGGTGGTGGCTGTGAGGGCTGATATTCAGCCATAC
Long Flanking Sequence:
TGGCGTTGAATAAATGTACAATCTGTACATCCTGCATTTAGCATTATGACGAGCTGTTAGCTGATTGAATGCATAGCTGCCTTTTTCACAGAAAGCTCATTTACTTTTTCTGCATCTCTTCTTTTCAAAATAAGAGTCCCACATACACTAATCCAAACTTAGATGAGCTTAAAAATAAAGGAAACAAATACATTTGTTGTGATCTCAATAGGAAACATTTTGGCCAATGAAACATAGTGTGCAGTATCCGTAACAGTTGTTTTTTTGTTCAGATTGGCCTGCTTTTCACTGCAAATTCAGCATTTTCTAAGTATATCCAGATTTTCATTCTATGGCATCTTTAAGGACATCCTATGCACATTAAACAACATATTATTTTGTTTTGATTGTTTGATTTCATCCTATGTACATATTTTTAATCCTCAGATCAGTATTTGCAGGACACTATGGGGCACCTGCTGGGCTGCCTAAAAAAAGAAAAGGAGCGGACGGCAGCATTT[C/T]AAGCGCTGGGGCTACTGGTGGTGGCTGTGAGGGCTGATATTCAGCCATACCTAAGCAAGATCCTGGAGATTATCAAAGCTGCATTGCCACCGAAAGACTTTGCGCACAAGTAAGAACCAAGAACCATCTAAATTGGAAGACTGTCAGTACATACAGTAGCTCACTTCTAAACAGTAGCTGAAGTAATTCAAAGTGCTGACCTTGAGTGGGAAATTTTCTCTACTTGATCTTTTCTTTACTTTAAACAATGATGGAGTTATAACATTTTACGGGGGCATTTATATACATATCGGGGCATATGTAGCTCCTTAAAAAAAGAAATATATTTTATTGTAGTTATAAACTGTTACGTTCCCCTCAACTCTGTCTAAGGGGACACGGGTTTTGTGTGTGTGTTTTAGCATTAAGGTCCTATGAGCAACCTTATAAAGGACCAAACAAAAGAAATATGCAACCTGAATGAAGATTAACAAAATATTTATTGAAGGATTAAGGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21374
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 910 2515 18 58
ENSDART00000122801 Essential Splice Site 910 2563 18 58
Genomic Location (Zv9):
Chromosome 8 (position 48429356)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46267614
GRCz11 8 46275493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGCTTCTGCCGTCAGCCTCTCCGAGTCCAAGTCCAGCCAGGATTCAGG[T/C]AATCAGATGCACCCGCTAACGAAAGCTCGCATCAACACAATTACTCACAG
Long Flanking Sequence:
TAACCTAGTTAAGCCTTTAAATTGCACTGTCATTCTAGTATCTTGCACAATATTATGTACCACATCATGGAAAAGACAAAAGAAATTAGTTGTTAGAAATTATATATCTTATAAAAATATATTTTAACATTTTCTCTTCAAAAAACAGGTTGATGTTCTTGTTAAAAAACTAAATGTTCTTGGTACTTTGTAATATAAAACCATTTGCATTTTTGCCACTAGGTTGAAGCTTTTGCAGCTTTTTGCAACAACTTAATTGTTTCATGTTCAATCAACATAAGTCAACTTAATTCCTTCACGTTGTCCCAACACAGATTGATTGTGTTGAACCCAGTATTTTTAACAGTGTGCTCCTGTCCCTCTCCTCAGGCCATTCGTGTTCTAGGTCTGCTAGGAGCTCTGGATCCCTACAAACACAAAGTGAACATCGGAATGATCGACCAGTCTCGAGATGCTTCTGCCGTCAGCCTCTCCGAGTCCAAGTCCAGCCAGGATTCAGG[T/C]AATCAGATGCACCCGCTAACGAAAGCTCGCATCAACACAATTACTCACAGATGCATAGAAGTGTGTGTCCGCCCATCTGATACATACATTCTCCAGCGCAAACCGAGCACATCTTCATAGACCGATTTCCCTTTCCAGTGACACAGCCAGAATTTTTTTGTTTCGCCTTTCACAAAAAATTAGCACACACATTTCATCCTTTTAATCATTACATTTTTTGAGTCTCCATTCCTTGCTTTTGTACACCATGTTTTTTTTGTCAAGTAAAATGAAATTTGATCAAATTATGATTGCATTTTCTTAAGAGGCCTGTTTGCTTTCTACCCGTGTCATCCTTTTGCTTATTCCATGTGCATGTTCCTAAAAGTCAGAACAAATAGTTCTCCATTATCTGACGAAAACGGTTTGCCTCTCACTGGCTTGAACGCTGTGTTCAAGTACAACATGTCCACTATTTCTAAAAACAGTCCCTTGATAGAATGTTGAATAGGGTCAATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16755
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 930 2515 19 58
ENSDART00000122801 Nonsense 930 2563 19 58
Genomic Location (Zv9):
Chromosome 8 (position 48419091)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46257349
GRCz11 8 46265228
KASP Assay ID:
2260-1081.1 (used for ordering genotyping assays)
KASP Sequence:
ACCAGCGAGATGCTGGTCAACATGGGCAACCTGCCGCTAGACGARTTTTA[C/A]CCAGCAGTCGCCATAGTGACCCTGATGCGTATCCTGCGTGACCCGTCKCT
Long Flanking Sequence:
TTTGTACTCAATGTCAGAAGTGTCAATCTCAAGCACTAGATAAAAATCGGTATCATTATCAGCTCAAATAAATGCTAGTTGTGCATCTCTAGTATTTATGAAATTTACCAATATTGTATCGGTATCAGACTTGGTAAGACTTGTATACAGGAGGTATCAGACTTGGTTTTGGTTGCATGTTGTTGTTTTTTTGTTAAAATCTATAACACAATAAGGCCAAAAAATACTATTTCTAGTATTTATGAAATTGACCAAAATTGTATCGGTATTGTAATTGTTTGAATGTTTTTTTGTGTATCTGTATCGTTATTTGCCCAGTTATGGGTCGTTATCGGGCCCAAACGTATTATGCATACTTTTATTTATATACATCTCACATGAAAGCAATCACCACTCATATTTTGACATCTAACATGTTGAATATGATTGTTCTCAACAGCTGACTACAGCACCAGCGAGATGCTGGTCAACATGGGCAACCTGCCGCTAGACGAGTTTTA[C/A]CCAGCAGTCGCCATAGTGACCCTGATGCGTATCCTGCGTGACCCGTCGCTGTCCAATCACCACACCATGGTCGTTCAGGCCGTGACCTTCATTTTCAAATCTCTTGGCCTCAAATGTGTGCAGTTCCTGCCTCAGGTCATGCCCACCTTTCTCAACGTCATCAGAGTGTGTGATGCCAGCATCAGAGAGGTACAATACTGTCCCACTGCATTCTACGTTATCTAAAGTCACCTTAATAACTAAATGAATAATTTGGTACAATCCACTTATTATGTACATACCTGTTTTTACATTGTACTTATATTTGAAAAAAAGATTTGCATGTAATTTACATCTCTAATTCTTTTGTGTTTTTAAAGTACACTGTTGTACACCTTAATCAATCGTTAAACCTACCCACACCACTAAACATGTCTCTAACCTTACCTGTCTCACCTAAGTAGCACCCCAATTGTAGTGCATTACAATATGAAAAGTACATTGCACTTATTTTTTGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34485
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 1170 2515 23 58
ENSDART00000122801 Essential Splice Site 1170 2563 23 58
Genomic Location (Zv9):
Chromosome 8 (position 48397798)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46236056
GRCz11 8 46243935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCTCCATGGACACACTGTCCTCGCTGGTCTTCCAGCTTGGTAAAAAG[G/A]TACAAGCTCTAAATCTACCCCAAGTCTGTCCAATAGTTATAGTTGCGTAT
Long Flanking Sequence:
CAGATGTGTTTTCTATTCTCTCTGTCCTGTTTTTTAAAAGCTTCAATGGTCAATATATACAAAGTAGGACGAATAATAATACATTCATAATTTATTGCAAATGAAGCAAATTAGGTGTGTACATTTGCCACATCAAATGAAGATAAAAAAACATAAAGATGGAAATATGCTCAGAAATTATAGCTGCTCGATTATGGGGAATACTGTAATCATGATTATTTTGGTCATAATTGTAATCATGATTATTTAAAACGATTATCAGTGGGCATATAGTCATATATTGACAGTTTAACTTAATGTTTTTAATTACTTTTGATCATTTCTTTTTGTTGTTTAGGGTTGCTTTGGAGACTTTAGATCGCCTGACTGAATCGTTGGACTTCACGGATTATGCCTCCAGAATTATCCACCCCATTGTTCGCACTCTTGATGTTACTCCAGAGCTGAGGAACTCCTCCATGGACACACTGTCCTCGCTGGTCTTCCAGCTTGGTAAAAAG[G/A]TACAAGCTCTAAATCTACCCCAAGTCTGTCCAATAGTTATAGTTGCGTATGTAATATTTCAGAGCATTATCTTTTTGGGTGCGGTGCCTCTAAAGATGTCTTAACGGTTTGAAAATAAACTTTTAAACCAATTCCCGGAGTTTTATGTGATGAAGTAGCTGTGTAATTATTTCCTAGTGTCTCGCTAATGCACAAAGAGGCTTTCAATCAGAGACAGGGATGAGGTCATGGCTTGAACCATTCTTCCAAAAACCCTTTTAAAATTACCAGTCAACATGTGGCCATCATGAACACCAGACGCATGTTCTGATCCCTTTGATCACTGCAGGCCACGATCCTCGGTTTCCTGTGTTAGAGGAGCAACGCTTTATTTGTGTACTTCCTACTTGATGGGCTTTTAGGCACATGCATACACATGTGCTCGCATTCATTCCCGACACCATTTTATTATACCGTATGGAATCAAAATAATCATTTCAGTATGCTTACCCTCCCATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31678
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 1266 2515 26 58
ENSDART00000122801 Nonsense 1266 2563 26 58
Genomic Location (Zv9):
Chromosome 8 (position 48387508)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46225766
GRCz11 8 46233645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCATGGGGTGCAGCCAGAAAGGTGTCCAAAGATGACTGGCTGGAGTG[G/A]TTGAGACGACTTAGTGTGGTCTTGCTAAAGGAATCCTCCTCACCAGCCCT
Long Flanking Sequence:
ATATTGAAATATGTTTTTTTCCCTTATAATTCAGGACTAGTATTTCTGATTTCAACTGTATATATTTTCATTTGAGCCACATCTGTCTTCAGAAGCACACTAGATCATCCTTTTCAGACAGAGATAGTGTACATATGTCCTCTGGGCGCACTATTGAAGGCATTGTCTGTTGTCTGCGATTCGTGAACGCATCATAATTACTCACAGGTGTTCCCTGAGAGCTTTTTCCACTGTCTTCCGAACCATCGCATTCAATTTCAAATATTGAACATTCACCCATGGATGGACTCAACAGCCTAGAGTGTCTTTTGTCTTCATTTAAAAAAAAAAAGAAGGCACACATACAAAGGTGCCTGAATGCTCTCTGTGTAGTAGCGTGCAAGGCAGATGACTAGATCAGAATTCATCACACATGTTTTGTCTGTGTATTAGTTCTCTTTCTGCTGTTTGCAGGCATGGGGTGCAGCCAGAAAGGTGTCCAAAGATGACTGGCTGGAGTG[G/A]TTGAGACGACTTAGTGTGGTCTTGCTAAAGGAATCCTCCTCACCAGCCCTGCGCTCCTGCTGGTCTCTAGCACAGACGTATATACCACTGGCTAGGTAAACTTTACCTTCTTTGTCTGTTTTTCTACTGAGGTACCATTTCAGTAACAGGCCCAGTGTTCATATGAAAGCTTGTGAAAATATATATTCAAGCCCTGGAAATCTAGAGTGCATAGATACAGTTTCTTGAATTTATTTTGTTCAAGACGTTTTTGCGACGGATACAAATCTTTATTTTTTTTTACTGGTCCATTAATATGTTATTTTTACAACATGTTAGTTATGCACATTTCCATATTATGTTAAAGGAACCCTCTATTTTATTTGGAATTCTGGTGGGAGAATCAGATCATTAAATCGGATTAAACCATTAGCATCTCAACAAATGTTTCAATAATTTTGCTATTGAATGCTTGACTATTTTGTAGTTTGTGTAGAAAATAGAAAATGTATATATTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27267
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 1352 2515 27 58
ENSDART00000122801 Essential Splice Site 1352 2563 27 58
Genomic Location (Zv9):
Chromosome 8 (position 48384952)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46223210
GRCz11 8 46231089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACACAGACATTGCTCAACCTCGCAGAATTCATGGAGCACAGCGATAAG[G/A]TCAGTGATGAAGCTGACATTCGACCACAAGCATCATGTTAGGTCTACATC
Long Flanking Sequence:
TCAACTAGTTAATTCTATGGGACTTGTAAAATGTTTTTAAAAAAAGTTGGTACTTAGCTTAGTTGAGTTCTTTATTTTTGTTAGCAAAATTAATTTTCGCTTTGCGATTTTTGGGGATTTGCATTTATTTATTTATTTATCTTTTATTCAAGACTTTATTTTTTGTTTGCAAAACTTTCTTTTATTTTTCAAGTATATATGGCCCTAGATTGACTCCATAGGAACCCTGTTAGCCTTTAAGACGTACATGTATTTTATGGTCAGAAGTAATTACTATCAACTCTTTTACGGACAAAATTATTAGAACCTGTGTGTGTGTATTGTCTGTTTCTTGTAGGGATCTTTTCAATGCTGCATTCTTATCGTGCTGGTCCGAGCTGAGTGAAGACCAGCAGGATGAGCTGATCCGCAGTATTGAGCTTGCTCTGACATCTCAGGATATTGCTGAGGTCACACAGACATTGCTCAACCTCGCAGAATTCATGGAGCACAGCGATAAG[G/A]TCAGTGATGAAGCTGACATTCGACCACAAGCATCATGTTAGGTCTACATCACTAGATGAATTGATTAACAAACTTTGCAAAACCAGAAAAATATCTCAAGATCTGGCAAGTTTGGCATATTTTATATTTAATAATGTTTATTCATGAATCTTAAACTGATTTACTGATTTTTTTTTTCTGTGTTCTGTATTTTTTTTTGTATTTAAATTAATCACAATGATAAACATGAAGTTGAAGTCCAAATTATTAGCTTATTTTTTAGCTTAGCTTATTGTTTAAAGGCTGATTTATACTTCTGCATCAAGCACACGAATATGGGCCGGCGAAGCCTTCACGTGGTCGCATAGCCCTCGCCGTGGCTGATGCCAACACTGACATGCACCTCTCAAAAAATTTAACTACACCTCGCAACGACACGTAGCGCAAGCTCTGTGATTGGTTGGCTTGGTATCGCTGACGAGTGTGGGCGTGGGTGAGAGCCGCGTGAACCCCTTGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 2038 2515 44 58
ENSDART00000122801 Essential Splice Site 2038 2563 44 58
Genomic Location (Zv9):
Chromosome 8 (position 48268031)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46106289
GRCz11 8 46114168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGATGGAGAGAGGACCACAAACCCTAAAAGAAACATCATTTAATCAG[G/A]TAAAAACGCTCATAACTCACTGTAAAGTCGAATTCCGTATGTAAGAGACT
Long Flanking Sequence:
CACACAGAAACGCCAACTGACCCAGCCGAGGCTCGAACCAGCAGCCTTCTTGCTGTGAGGCGAGAGCACTACCTACTGGACCACCGCGTCACCCCAATACAACCACAAAAATACAAATAATAATTTAAGCCACGGAACAAAAAACAACCCAAGTAGTTAAAAGTAATCCAACTCGAGGACTTGGCAGCCATGATGGTGGGTATGGTAGCAGCTTTGGTAATTGCTATTTTTAAGCTTAGCCAAGGATAAAAACACAATCCGAAACATCTGCCAAAAATCCAAATCCCCACATGAGCACTGTTTCTACCCATGTTTAGGTGAGCGAGGAGCTTATCAGGGTCGCTATTCTCTGGCATGAAATGTGGCACGAGGGGCTGGAGGAAGCGTCACGTCTATATTTTGGAGAGAGGAACGTCAAGGGAATGTTTGCCGTTCTGGAGCCCCTCCATGCCATGATGGAGAGAGGACCACAAACCCTAAAAGAAACATCATTTAATCAG[G/A]TAAAAACGCTCATAACTCACTGTAAAGTCGAATTCCGTATGTAAGAGACTTTTATAAGCTAATAATGTCATGTTACAGTTAAATCACCACTGTTAAGGAGTATTTTGAGTCCAGTAAAATCACTTCACCACATGATTTATTGTGTATATTCTGTTTGTATATCAGGTAATAGTTCATTTTACAGTGTTGATCTTATATACAGTAGATGGAAGGCGTAATCATTATTACAGTAGGAATAAGGATGTTTCCAATAGTAACTTTTCACGTTAGTTCATAATACATTAGGATTACACTTTATCCATTATTTTTGGTGTCTTTTTAAATGCAAAAACAATAATAACAAAAGATTGGCTTTTGTTATAACAAATATTTTTGGATCTTTGACATTTTTAAAAATTCATCTTTGCACATTTGAATTAAGACTTGGAGAACTTTTGTTTTATACCCAAGTTTTAGAAAGCAGATTCCCACCTGAAGTTTGTATTCCATGAGCTCTCACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8325
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2162 2515 47 58
ENSDART00000122801 Nonsense 2162 2563 47 58
Genomic Location (Zv9):
Chromosome 8 (position 48259701)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46097959
GRCz11 8 46105838
KASP Assay ID:
2260-1078.1 (used for ordering genotyping assays)
KASP Sequence:
GCCATGAGTTCATGTTCCTGCTGAAGGGTCATGAAGATTTACGACAGGAC[G/T]AGAGGGTCATGCAGCTTTTTGGCTTGGTGAACACTCTACTGGCTAATGAC
Long Flanking Sequence:
TTAAAAACCATTAACTAATACTTATAGCTTAATAAAGTATTATATAATTAGTTTAATAATAGTCAATAAGGTAGAAGTGAGGTTTTGGTTTTGGGTAGGGTTAGGGATGTTAAATAAGATCGTACTTCATAACTACTAAATAACACTTAATATCTTAATAATAGGCAGGTAATAAGCCAGTAGTACATAGCATAAATTGTGACCTAAACTAAAGTGTGACCAAAATTAAAAATGATTTAAATATGACATATAGACATCTCTGTTCTTTTGTGTAAAAATAAAACAAGGGTTTGTGAGTTGTGGAGTGCAAAAGTGTAATTCTGTCTTTGTTTCCTATACACATGCTGTAGTCTGGCCAGTAAAGGTGAATGCATGTAGAACAGTGCAGTAGGATTTAAAGGATTTGACAAAGCTTTCTCTGTTCTCTTCTGCACCCTGCAGGCAGCAATGGCCATGAGTTCATGTTCCTGCTGAAGGGTCATGAAGATTTACGACAGGAC[G/T]AGAGGGTCATGCAGCTTTTTGGCTTGGTGAACACTCTACTGGCTAATGACCCAGCCTCCCTGCGCAAGAACCTGAGGCAAGTCTCTTGTGTTCATGTGTCTGAGCATTGCAGAATTTCAGACGTTCTCATTTCTTTACAACACATTATGTCAGGCAAAAAATGGAAATAATATACTCTTGCATAAAAAAACACAAAGCTGACAGCTGTTGGTTTGGTATGTTCCACACTTTGCCTCTCGTCAAATAAATGTTAGGCCGATTGAGGCCCCGTTTACACTAGTGCGTTTTAGTTTTAAAACGGCGTTTTAGAATGAAAACGATCTGCGTCACACTCCACACGTTTTACCCAGCGTTTCTGAACTGCTCTCCGTCCACACCAAAACGCTGAAAACGCACATCACGTGACCACACAGACACTCTCGGGCAAGCGCTGCAGCCCATCTACCCAGATGGGCTCTGCTAGTCGGACCTCTCATCAAGCATCTCCCGCTGGATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41292
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2221 2515 48 58
ENSDART00000122801 Nonsense 2245 2563 48 58
Genomic Location (Zv9):
Chromosome 8 (position 48253069)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46091327
GRCz11 8 46099206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGGTTCCTCACTGTGACACGCTGCACGCACTGATTCGAGACTACAGA[G/T]AGAAGAAGAAGATCCTGCTCAACATTGAACATCGCATCATGCTCAGGGTA
Long Flanking Sequence:
TAGCGTCAACGCTTGACTGAGGGCGTGTCTGAAGATGGGGCTGACATGATTATCCTAACAGCGTCAAATGAAATTTGTCCCCAATTGGCTACTGTCATAGCTGGGGTATTTGCATGAAGCAATCTGATTGGCTGGCAATTTCGTTGGCACTTGAAAAGTTGAGAAATCCCCAATTTCTGCAGCGAGCAATGAGCAATGAACGTCATTGATTCAAAGGGAATGGAAAGCGCTGACGCCCTGTGTGAATGAGGCGTTACAAGTCTTGAGACTAGTGGATTTGTCCTATTTCTAAATATCACTAAGCTTATGGTGTAGTTACATTTTGATGTTGTCATTTTTGTGGCTCATGTTTTGATTTTTTTCTCTCTCTCTATCTCTGATAAATGTTTCTTTTGAGCAGTATTCAGCGCTATGCTGTGATCCCGCTTTCCACCAACTCTGGCCTGATTGGCTGGGTTCCTCACTGTGACACGCTGCACGCACTGATTCGAGACTACAGA[G/T]AGAAGAAGAAGATCCTGCTCAACATTGAACATCGCATCATGCTCAGGGTAATGTGTCAAACCCTAAAATTATTTTTTTACTGTAAAATTACTGTACGGTTTCTTGCTGTATTACTGAAAATTACTGTATCCTACTGTATTCATTTTGACCGGAAGTTGCTGCAACTTTTATTTCACGACTTCCACATGAAGTTGAATGTTGTTAAGGGGGCGGAGCTTTTTGTGCATCATTTCCTCATACTAATGGTAATAGAGGCGTGGTTAAGAATATTGTGGCTGAAGCCACCAAACTGACATCAGCAGTGAAAGACCACCACTCCAAAGTTTCAAACGGTTGGACGTTGACACTAAACGTAGACCTTATTAGACCTTAAAAACTTAGGAAAATGACTGTATTGTGGAATATCAATGGAAAGACATTTTAAAGTTAGTCCACTCCTCCTTTATATGCGCCAGACATGACCTAATGCAATGTGAGGTGCTCCACAGAGCTCACTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11792
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2435 2515 55 58
ENSDART00000122801 Nonsense 2483 2563 55 58
Genomic Location (Zv9):
Chromosome 8 (position 48242917)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46081175
GRCz11 8 46089054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTCGTGTAGAAGCCATGGAGGGTATTGACCTGGGAGAAACAACGCAC[A/T]ARAAGCCTGGAACTACMGTGCCTGAGTCCATTCACTCTTTCAGTAAGTCT
Long Flanking Sequence:
ACAGTGAGTACACAACCTTTACTTGTTCAAAACCATATCAGAGTCATGCAACTGATGCTTCTCCGTCTTACAGCAAACACTAAAGGAAATAAGCGATCCCGGACCAGAACTGACTCCTATACTGCAGGACAGTCTGTTGGTAAGCCTTGGACTTCATCTCCATTCCAATTATCAGCAGCAAACTAAATTAAACTCTGTGATGAAATGAAAATTGACAGTTTTATTTGGTGTGTTTTTCATGTCAAAACTTGTTGTCAACTATGATATGCTGTTACTAGTCCTTCTGTACAGTACAGAGATTTACTAGAAATCCCATATACTTTGCTTTCATTTTTTAGAATGCCTCATAATGGCAGTGGCATACATATTTAAGTGCTCATGTTCATATAGAATTTCCATCAAAACTAACGTTCCTGGAAATCGATACATTTTTGTGGTATGTTTTTGGTATGTTTCGTGTAGAAGCCATGGAGGGTATTGACCTGGGAGAAACAACGCAC[A/T]AAAAGCCTGGAACTACCGTGCCTGAGTCCATTCACTCTTTCAGTAAGTCTTTAAAGTGTCTTTGTTTGTTGTCTTTGTTGTTGTTTAATTATTGATATTATTGATTTCTTGTAATGGAGGGTTTGTAAGAAAGGCCCAATCCCAATTCTATTTTGTACCCCTTCCCCTTGGCCCTTAAAATCGAGGGTGAAGGGGAAGGGCTTCAAAATTTACTCGTAAGAATTGGGACAGCGCTACAGCACCTGCACACGTCATCACATGTCGTTGCGATCTCTTGCTTCATATGAGATCAGACGATCTCGACTGCTGTAGTTATTCCAGTTGGGTTATTTTTTGGTATTTATGTTCAGGAAATCTCTGAACGATCTAATGCGGCAATAAGATCGTAACTATACTGTGCATTTACTCTATGGTCATATTCAGCAATGTAAACACACGAACCCAACATTAACATTATTGCAGACACTGTAAAAAGCTCATTCACAGCCACTAGACATTAC
Associated Phenotype:
Not determined