Busch Lab

ZMP

TSPAN17

Ensembl ID:
ENSDARG00000053183
Description:
tetraspanin 17 [Source:HGNC Symbol;Acc:13594]
Human Orthologue:
TSPAN17
Human Description:
tetraspanin 17 [Source:HGNC Symbol;Acc:13594]
Mouse Orthologue:
Tspan17
Mouse Description:
tetraspanin 17 Gene [Source:MGI Symbol;Acc:MGI:1921507]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35766 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa5873 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35767 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35766
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101132 Essential Splice Site 24 209 2 8
Genomic Location (Zv9):
Chromosome 14 (position 51923284)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149930.1 60148
GRCz11 14 49730744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTAATAATCGAAAGAATAAGTTAAGAAGAAATTCCTAATTACACTTA[T/C]CAACGGCCACTTTATTAGGTACACCTTACTAGTAAGGGGTTGGATCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5873
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101132 Essential Splice Site 35 209 3 8
Genomic Location (Zv9):
Chromosome 14 (position 51923615)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149930.1 60479
GRCz11 14 49731075
KASP Assay ID:
554-3802.1 (used for ordering genotyping assays)
KASP Sequence:
ACATGGTCAGCAACAAAAATTTCATTTTTTGGGAGAACCATCCCTTTAAT[G/T]AGCTGCTGGTRAAAATGTCAAACAATCAAAGATCACAGATTTTAGACKAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35767
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101132 Nonsense 119 209 6 8
Genomic Location (Zv9):
Chromosome 14 (position 51926485)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149930.1 63349
GRCz11 14 49733945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTCCTGGAGCTCACTGCTGGCATTTTAGCCTTCGTCTTTAAAGACTG[G/A]ATCAAAGACCAGCTGAACTTCTTCATCAACAACAATGTTAAAGCATATCG
Associated Phenotype:
Not determined