Busch Lab

ZMP

alg3

Ensembl ID:
ENSDARG00000053155
ZFIN ID:
ZDB-GENE-050522-334
Description:
dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase [Source:RefSeq peptide;Acc:NP_001018
Human Orthologue:
ALG3
Human Description:
asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Alg3
Mouse Description:
asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) Gene [Source:MGI Sy

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6860 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44547 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6860
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075146 Essential Splice Site 331 434 8 9
ENSDART00000144024 Essential Splice Site 95 151 3 4
Genomic Location (Zv9):
Chromosome 2 (position 45040114)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45125615
GRCz11 2 44978613
KASP Assay ID:
554-4421.1 (used for ordering genotyping assays)
KASP Sequence:
TTTWATTYTKARCTTATATGACTATAAACGGYTCCTTAACCCAGATTGTA[C/T]AGATGGTTCTTATTCTGTTTACATCWAACTTCATTGGCATGTGCTTCAGC
Long Flanking Sequence:
ACCTCAATTTTGTGCTATGCTTAGGGCTGGGCAATTTTTTTTAATTGGGGAGTGGGGGTGGGGGGTAGAGCTTTTTGTTAAATTATAGTTCTGAAAATATAATGTTTATATTTTACTGACCTTTGTCATTTTTTAATGTGTTTTTACAGGTCTGGGAGCAGTATTTGGACTATACTAAAAGATCCATCTGAGAGAAAGGAGACTGCACATAAAGTTAATGCCGATCATATCCTTTCTGTGGTAGTTAAAATCAAATTGGTTTAAAGTCTTTTATACATACATCCAGCAGTCAACATTTGAAGTGGATCAAACAATTTTCCAAAATTGTCCTGAGAAAACAATGGGTGTTAAATAGTTTTTGGGAAAACACTTTTGGGAAAACACTTTGTTTCCACTTCAAATGTTGACTACTGTATATTTCAGGCATGTATAAATATTCAATTCTTCTGATTTTATTCTGAACTTATATGACTATAAACGGTTCCTTAACCCAGATTGTA[C/T]AGATGGTTCTTATTCTGTTTACATCTAACTTCATTGGCATGTGCTTCAGCAGATCTCTGCATTATCAGTTTTATGTCTGGTATTTTCATACGCTGCCCTACCTGCTGTGGAGTGGAGGAGTGAAGAAGCTGGCACACCTACTCAGGTAAAACATATCTCAATATTTAGATAACACTGTAGTGTACAGTCAGTCTAATGCAGATATATAGATGATTAAAGTTCCCACACTTTATCTGGAAAAAGTGGAAATTTACAGGGTTGTTTTCCAGTCATGAATGTGATCTGTGGTCTTATTTTTAAAATGTTGCATAGAAACCTTAATAACGCTGAAAGCCAGAGTAAATTGTAATTTATTAGTTAATGATTATGGCTCATATGATGATTTAAAGTGGTTAAACTAAGTCCACATTTAAGGTATATGTTTATTTAGAGTTTACTTACATCTGCGTGGATTCTTCAGGATTTTTTTTTTTATAGATATCAATCTTTGTGTGGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44547
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075146 Essential Splice Site 379 434 8 9
ENSDART00000144024 Essential Splice Site 143 151 3 4
ENSDART00000075146 Essential Splice Site 379 434 8 9
ENSDART00000144024 Essential Splice Site 143 151 3 4
Genomic Location (Zv9):
Chromosome 2 (position 45040261)
Other Location(s):
Assembly Chromosome Position
GRCz11 2 44978760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACCTGCTGTGGAGTGGAGGAGTGAAGAAGCTGGCACACCTACTCAGG[T/C]AAAACATATCTCAATATTTAGATAACACTGTAGTGTACAGTCAGTCTAAT
Long Flanking Sequence:
AGGTCTGGGAGCAGTATTTGGACTATACTAAAAGATCCATCTGAGAGAAAGGAGACTGCACATAAAGTTAATGCCGATCATATCCTTTCTGTGGTAGTTAAAATCAAATTGGTTTAAAGTCTTTTATACATACATCCAGCAGTCAACATTTGAAGTGGATCAAACAATTTTCCAAAATTGTCCTGAGAAAACAATGGGTGTTAAATAGTTTTTGGGAAAACACTTTTGGGAAAACACTTTGTTTCCACTTCAAATGTTGACTACTGTATATTTCAGGCATGTATAAATATTCAATTCTTCTGATTTTATTCTGAACTTATATGACTATAAACGGTTCCTTAACCCAGATTGTACAGATGGTTCTTATTCTGTTTACATCTAACTTCATTGGCATGTGCTTCAGCAGATCTCTGCATTATCAGTTTTATGTCTGGTATTTTCATACGCTGCCCTACCTGCTGTGGAGTGGAGGAGTGAAGAAGCTGGCACACCTACTCAGG[T/C]AAAACATATCTCAATATTTAGATAACACTGTAGTGTACAGTCAGTCTAATGCAGATATATAGATGATTAAAGTTCCCACACTTTATCTGGAAAAAGTGGAAATTTACAGGGTTGTTTTCCAGTCATGAATGTGATCTGTGGTCTTATTTTTAAAATGTTGCATAGAAACCTTAATAACGCTGAAAGCCAGAGTAAATTGTAATTTATTAGTTAATGATTATGGCTCATATGATGATTTAAAGTGGTTAAACTAAGTCCACATTTAAGGTATATGTTTATTTAGAGTTTACTTACATCTGCGTGGATTCTTCAGGATTTTTTTTTTTATAGATATCAATCTTTGTGTGGGAAGTGACATAAATGCATTCCCACCCCCATTTTGTGTGTTCACCCAACACGATCTCACAGCAGTTCATAAATTTTAGATTTAGTGCCTAATTCATATGAAATCATACGATCTTATACTAATAATTTTGTACAATCACGGTTGGGTTTAGGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3397
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075146 Essential Splice Site 379 434 8 9
ENSDART00000144024 Essential Splice Site 143 151 3 4
ENSDART00000075146 Essential Splice Site 379 434 8 9
ENSDART00000144024 Essential Splice Site 143 151 3 4
Genomic Location (Zv9):
Chromosome 2 (position 45040261)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45125762
GRCz11 2 44978760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTACCTGCTGTGGAGTGGAGGAGTGAAGAAGCTGGCACACCTACTCAGG[T/G]AAAACATATCTCAATATTTAGATAACACTGTAGTGKACAGTCAGTCTAAT
Long Flanking Sequence:
AGGTCTGGGAGCAGTATTTGGACTATACTAAAAGATCCATCTGAGAGAAAGGAGACTGCACATAAAGTTAATGCCGATCATATCCTTTCTGTGGTAGTTAAAATCAAATTGGTTTAAAGTCTTTTATACATACATCCAGCAGTCAACATTTGAAGTGGATCAAACAATTTTCCAAAATTGTCCTGAGAAAACAATGGGTGTTAAATAGTTTTTGGGAAAACACTTTTGGGAAAACACTTTGTTTCCACTTCAAATGTTGACTACTGTATATTTCAGGCATGTATAAATATTCAATTCTTCTGATTTTATTCTGAACTTATATGACTATAAACGGTTCCTTAACCCAGATTGTACAGATGGTTCTTATTCTGTTTACATCTAACTTCATTGGCATGTGCTTCAGCAGATCTCTGCATTATCAGTTTTATGTCTGGTATTTTCATACGCTGCCCTACCTGCTGTGGAGTGGAGGAGTGAAGAAGCTGGCACACCTACTCAGG[T/G]AAAACATATCTCAATATTTAGATAACACTGTAGTGTACAGTCAGTCTAATGCAGATATATAGATGATTAAAGTTCCCACACTTTATCTGGAAAAAGTGGAAATTTACAGGGTTGTTTTCCAGTCATGAATGTGATCTGTGGTCTTATTTTTAAAATGTTGCATAGAAACCTTAATAACGCTGAAAGCCAGAGTAAATTGTAATTTATTAGTTAATGATTATGGCTCATATGATGATTTAAAGTGGTTAAACTAAGTCCACATTTAAGGTATATGTTTATTTAGAGTTTACTTACATCTGCGTGGATTCTTCAGGATTTTTTTTTTTATAGATATCAATCTTTGTGTGGGAAGTGACATAAATGCATTCCCACCCCCATTTTGTGTGTTCACCCAACACGATCTCACAGCAGTTCATAAATTTTAGATTTAGTGCCTAATTCATATGAAATCATACGATCTTATACTAATAATTTTGTACAATCACGGTTGGGTTTAGGGG
Associated Phenotype:
Not determined