Busch Lab

ZMP

helb

Ensembl ID:
ENSDARG00000053127
ZFIN ID:
ZDB-GENE-030729-16
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYS3]
Human Orthologue:
HELB
Human Description:
helicase (DNA) B [Source:HGNC Symbol;Acc:17196]
Mouse Orthologue:
Helb
Mouse Description:
helicase (DNA) B Gene [Source:MGI Symbol;Acc:MGI:2152895]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20235 Nonsense Available for shipment Available now
sa15508 Nonsense Available for shipment Available now
sa30607 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20235
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 663 1176 5 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11839403)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12776030
GRCz11 4 12774879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCTTAGCATGCTTACCAAACACGCACAACTCCAGAAGTTCATCATTT[T/A]GGGTATAGACATAATTCATGTAGTTCTGTAGTATTCTGTAGATCATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15508
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 721 1176 7 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11839019)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12775646
GRCz11 4 12774495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTATTTTCATAATCTTTTAGCATCTCTGAGATGGGYAAAAAAAAGTATTA[C/A]AAGCCTCTGGACTTTGATGCCAYCATAGACATGACAAACCCCTCTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30607
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 891 1176 11 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11837405)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12774032
GRCz11 4 12772881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGGATGTGACTAAATCTGTCGAGAATGAAAAAAATAAAATGGTGCGT[C/T]AACTGACACTCGATGATAAAAGCGACCGCCAGGTGACTTGTAACTACAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26253
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 967 1176 12 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11836549)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12773176
GRCz11 4 12772025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCGGTGACTCGTGGTCAGAAGCGTGTGTATGTGGTGGGTACAGAGTA[T/A]GATCTAGAAGGTGCCATCAGGAAGAGGATCACCCCTCGTAACACACGACT
Associated Phenotype:
Not determined