Busch Lab

ZMP

si:dkey-78p20.2

Ensembl ID:
ENSDARG00000053113
ZFIN ID:
ZDB-GENE-050309-166
Description:
Si:dkey-78p20.2 protein [Source:UniProtKB/TrEMBL;Acc:Q58EG8]
Human Orthologue:
PLA2R1
Human Description:
phospholipase A2 receptor 1, 180kDa [Source:HGNC Symbol;Acc:9042]
Mouse Orthologue:
Pla2r1
Mouse Description:
phospholipase A2 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:102468]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa38827 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17385 Nonsense Available for shipment Available now
sa35033 Nonsense Mutation detected in F1 DNA Not yet available
sa6194 Nonsense Mutation detected in F1 DNA Not yet available
sa41788 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38827
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Essential Splice Site 153 1726 2 35
ENSDART00000148030 None None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11248109)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11143411
GRCz11 11 11127032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGAAAAGAGAAGGGAGCACGGATAACATCTGTCAGCGGACGTATCGAA[G/A]TATGATTTTACTATTTTACTACCATTTGGGAATAATTATGATTTTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17385
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 199 1726 3 35
ENSDART00000148030 None None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11262826)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11158128
GRCz11 11 11141749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCCCACYGATGAAAATACACTGGAGTGGTGCTCTACTACTGCAAACTA[T/A]GATCAAGAGCAGAARTGGGGGAATTGTCTRAAAWATGGTGAGGTTTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35033
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 229 1726 4 35
ENSDART00000148030 None None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11265661)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11160963
GRCz11 11 11144584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGATGTTCTTCTTTATGGGAGAAAGAACCTGTGACTGGACGCTGCTA[T/A]CAGGTGGTGTCCACAGCTGTGGTGACCTGGCATGAGGCGCGGGACGCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7663
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 276 1726 5 35
ENSDART00000148030 None None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11269968)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11165268
GRCz11 11 11148889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTTTCTGTCTCAGTTAAAGATCGCAAAGATTTGCCCAGCAAGCTCTG[G/A]ATCGGAGTGAACCATCTGGATTGGATGCAGGGTTGGCAGTGGTCTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 481 1726 9 35
ENSDART00000148030 Nonsense 161 1406 4 30
Genomic Location (Zv9):
Chromosome 11 (position 11276551)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11171554
GRCz11 11 11155175
KASP Assay ID:
554-4364.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCAGCATCATACGTGGTCTGTKTCTGACTGTGATAAGCCACGGGCTTA[T/A]ATGTGTATGAGGAACTCGCAGAATGTGAATGAAAGTGCAGCAGAGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41788
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 1319 1726 29 35
ENSDART00000148030 Nonsense 999 1406 24 30
Genomic Location (Zv9):
Chromosome 11 (position 11303269)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11198272
GRCz11 11 11181893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATATAGCTGCTAATTTTTGCCCTGTATGATCTCTTTTGTATAGATGAG[C/T]AGCTGAAATGGCTGGATGGCACTTATGTGCAGTTCTCCAACTGGAAATAT
Associated Phenotype:
Not determined